Incidental Mutation 'R8221:Trip12'
ID 636667
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Name thyroid hormone receptor interactor 12
Synonyms Gtl6, 1110036I07Rik, 6720416K24Rik
MMRRC Submission 067639-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8221 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 84698910-84818237 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 84743771 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 512 (T512K)
Ref Sequence ENSEMBL: ENSMUSP00000140267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894]
AlphaFold G5E870
Predicted Effect possibly damaging
Transcript: ENSMUST00000027421
AA Change: T512K

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: T512K

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185909
SMART Domains Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186465
AA Change: T512K

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: T512K

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186648
AA Change: T506K

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: T506K

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186894
AA Change: T512K

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: T512K

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 3e-20 SMART
PDB:1WA5|B 447 641 7e-6 PDB
Blast:ARM 476 516 6e-6 BLAST
WWE 764 839 6.9e-25 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A G 11: 100,410,576 (GRCm39) F134S probably damaging Het
Acsl5 T C 19: 55,257,262 (GRCm39) probably null Het
Adam29 G T 8: 56,325,463 (GRCm39) N330K probably benign Het
Adgrv1 A G 13: 81,677,033 (GRCm39) S1933P probably benign Het
Afap1l2 T C 19: 56,902,824 (GRCm39) H785R probably damaging Het
Ahnak T A 19: 8,987,800 (GRCm39) L3028* probably null Het
Ajuba T C 14: 54,807,847 (GRCm39) T462A possibly damaging Het
Ankrd36 A G 11: 5,534,016 (GRCm39) N289S possibly damaging Het
Ankrd46 A T 15: 36,486,001 (GRCm39) L84Q probably damaging Het
Ankrd54 T G 15: 78,940,270 (GRCm39) D163A probably damaging Het
Arhgef28 A G 13: 98,282,064 (GRCm39) L10P probably benign Het
Atm A T 9: 53,367,288 (GRCm39) probably null Het
Azin1 G C 15: 38,492,572 (GRCm39) F312L probably damaging Het
C2cd4c A G 10: 79,448,482 (GRCm39) S222P probably damaging Het
Cdyl A G 13: 36,000,147 (GRCm39) T143A probably benign Het
Clhc1 G A 11: 29,503,751 (GRCm39) V56I possibly damaging Het
Cntn4 T C 6: 106,486,471 (GRCm39) S300P probably benign Het
Col12a1 A G 9: 79,551,224 (GRCm39) Y2131H probably damaging Het
Cyp3a41b A G 5: 145,506,190 (GRCm39) S287P probably benign Het
Dctn4 A G 18: 60,689,401 (GRCm39) D424G probably benign Het
Dnajb8 C T 6: 88,199,940 (GRCm39) R159C possibly damaging Het
Dop1b A G 16: 93,546,847 (GRCm39) T284A probably benign Het
E330034G19Rik A C 14: 24,346,135 (GRCm39) probably null Het
Ehhadh G A 16: 21,581,373 (GRCm39) P540S possibly damaging Het
Emsy T C 7: 98,297,111 (GRCm39) E24G probably damaging Het
F930015N05Rik A C 11: 64,326,418 (GRCm39) L74W unknown Het
Fat1 A G 8: 45,406,390 (GRCm39) D1047G Het
Galnt7 A G 8: 58,005,600 (GRCm39) V211A possibly damaging Het
Gdap2 T C 3: 100,109,611 (GRCm39) C543R unknown Het
Ghr A C 15: 3,362,901 (GRCm39) D190E probably benign Het
Glrx A G 13: 75,995,346 (GRCm39) M89V probably benign Het
Gm10323 A C 13: 67,000,859 (GRCm39) Y91* noncoding transcript Het
Gnb4 A T 3: 32,644,184 (GRCm39) D153E possibly damaging Het
Gnptab G T 10: 88,276,254 (GRCm39) probably null Het
Grip2 T C 6: 91,762,665 (GRCm39) D193G possibly damaging Het
Igsf3 T C 3: 101,347,038 (GRCm39) W658R probably damaging Het
Ip6k1 T A 9: 107,923,115 (GRCm39) F416I probably benign Het
Klhl1 T G 14: 96,517,546 (GRCm39) T377P possibly damaging Het
Lrrc38 G A 4: 143,077,303 (GRCm39) G189R probably damaging Het
Lrrfip1 T C 1: 91,042,878 (GRCm39) S428P probably benign Het
Megf10 A G 18: 57,416,893 (GRCm39) D754G probably benign Het
Mrgprx2 T A 7: 48,132,527 (GRCm39) Y97F probably benign Het
Msantd2 T G 9: 37,400,684 (GRCm39) V22G probably damaging Het
Myl6b T C 10: 128,333,209 (GRCm39) K11R unknown Het
Nab2 C A 10: 127,498,645 (GRCm39) V475L probably benign Het
Npas1 T C 7: 16,189,890 (GRCm39) E552G probably damaging Het
Pknox2 T C 9: 36,821,040 (GRCm39) N274S possibly damaging Het
Pmepa1 A T 2: 173,069,700 (GRCm39) L247Q probably damaging Het
Poll T C 19: 45,542,047 (GRCm39) K420E probably damaging Het
Polr2a A G 11: 69,628,344 (GRCm39) V1283A probably benign Het
Ppil4 A T 10: 7,671,444 (GRCm39) Y36F probably benign Het
Pramel20 T G 4: 143,298,530 (GRCm39) Y158D probably benign Het
Psd2 C T 18: 36,113,478 (GRCm39) R317W probably damaging Het
Pspc1 T A 14: 57,015,616 (GRCm39) M1L probably benign Het
Qrsl1 A T 10: 43,758,080 (GRCm39) F338I possibly damaging Het
Rcor3 A G 1: 191,814,749 (GRCm39) Y77H unknown Het
Sbno2 G A 10: 79,905,845 (GRCm39) P157L probably benign Het
Scn10a C T 9: 119,446,829 (GRCm39) V1400I probably damaging Het
Setd3 C G 12: 108,073,612 (GRCm39) G555A possibly damaging Het
Slc12a4 A T 8: 106,678,601 (GRCm39) M245K probably benign Het
Slc1a5 T A 7: 16,515,902 (GRCm39) L26Q probably benign Het
Slc38a3 T G 9: 107,534,908 (GRCm39) M156L probably damaging Het
Slc45a2 A T 15: 11,001,233 (GRCm39) I111F probably benign Het
Slc4a3 T A 1: 75,528,810 (GRCm39) M491K probably benign Het
Son A G 16: 91,453,734 (GRCm39) D827G probably damaging Het
Sppl2c A T 11: 104,077,710 (GRCm39) H170L probably damaging Het
St6gal2 T A 17: 55,797,935 (GRCm39) probably null Het
Taf4b T A 18: 15,031,106 (GRCm39) L830H probably damaging Het
Tex22 A G 12: 113,038,696 (GRCm39) probably null Het
Tiam2 C T 17: 3,568,860 (GRCm39) R1669C probably damaging Het
Tmprss15 T A 16: 78,821,223 (GRCm39) N506I probably damaging Het
Topors A T 4: 40,260,686 (GRCm39) I866K unknown Het
Ubr1 T A 2: 120,791,585 (GRCm39) H133L probably damaging Het
Wwtr1 T C 3: 57,366,441 (GRCm39) D422G probably damaging Het
Zfp689 A C 7: 127,043,758 (GRCm39) C291G probably damaging Het
Zfyve9 A G 4: 108,576,877 (GRCm39) L68P possibly damaging Het
Zswim5 G T 4: 116,735,219 (GRCm39) R188L probably benign Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84,708,262 (GRCm39) missense probably damaging 1.00
IGL00430:Trip12 APN 1 84,741,582 (GRCm39) missense probably damaging 0.96
IGL00465:Trip12 APN 1 84,741,582 (GRCm39) missense probably damaging 0.96
IGL00819:Trip12 APN 1 84,731,993 (GRCm39) missense probably damaging 1.00
IGL00900:Trip12 APN 1 84,702,485 (GRCm39) missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84,729,605 (GRCm39) missense probably damaging 0.99
IGL01087:Trip12 APN 1 84,735,580 (GRCm39) missense probably damaging 0.99
IGL01400:Trip12 APN 1 84,729,699 (GRCm39) missense probably damaging 0.99
IGL01521:Trip12 APN 1 84,743,919 (GRCm39) splice site probably benign
IGL01619:Trip12 APN 1 84,792,631 (GRCm39) missense probably damaging 0.99
IGL01796:Trip12 APN 1 84,705,999 (GRCm39) missense probably benign 0.42
IGL01975:Trip12 APN 1 84,792,534 (GRCm39) splice site probably benign
IGL02190:Trip12 APN 1 84,743,791 (GRCm39) missense probably damaging 0.98
IGL02474:Trip12 APN 1 84,771,854 (GRCm39) missense probably benign
IGL02517:Trip12 APN 1 84,721,535 (GRCm39) unclassified probably benign
IGL02631:Trip12 APN 1 84,743,729 (GRCm39) missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84,716,536 (GRCm39) missense probably damaging 1.00
IGL03161:Trip12 APN 1 84,738,853 (GRCm39) unclassified probably benign
IGL03388:Trip12 APN 1 84,720,907 (GRCm39) missense probably damaging 0.99
cardamom UTSW 1 84,726,997 (GRCm39) missense probably damaging 0.99
pungent UTSW 1 84,771,636 (GRCm39) missense possibly damaging 0.70
spices UTSW 1 84,771,596 (GRCm39) missense probably benign 0.10
sulfuric UTSW 1 84,736,771 (GRCm39) missense probably benign 0.19
Turmeric UTSW 1 84,732,064 (GRCm39) missense probably benign 0.07
LCD18:Trip12 UTSW 1 84,754,482 (GRCm38) unclassified probably benign
R0090:Trip12 UTSW 1 84,709,857 (GRCm39) splice site probably benign
R0111:Trip12 UTSW 1 84,736,854 (GRCm39) unclassified probably benign
R0471:Trip12 UTSW 1 84,703,928 (GRCm39) missense probably damaging 1.00
R0486:Trip12 UTSW 1 84,738,805 (GRCm39) nonsense probably null
R0557:Trip12 UTSW 1 84,702,468 (GRCm39) missense probably damaging 1.00
R0570:Trip12 UTSW 1 84,729,269 (GRCm39) missense probably damaging 1.00
R0614:Trip12 UTSW 1 84,735,482 (GRCm39) missense probably damaging 1.00
R0627:Trip12 UTSW 1 84,746,318 (GRCm39) missense probably damaging 1.00
R0630:Trip12 UTSW 1 84,771,636 (GRCm39) missense possibly damaging 0.70
R0657:Trip12 UTSW 1 84,736,771 (GRCm39) missense probably benign 0.19
R0741:Trip12 UTSW 1 84,722,902 (GRCm39) missense probably benign 0.09
R0862:Trip12 UTSW 1 84,721,730 (GRCm39) missense probably damaging 0.99
R0864:Trip12 UTSW 1 84,721,730 (GRCm39) missense probably damaging 0.99
R1124:Trip12 UTSW 1 84,714,758 (GRCm39) missense probably damaging 1.00
R1252:Trip12 UTSW 1 84,754,071 (GRCm39) nonsense probably null
R1455:Trip12 UTSW 1 84,736,821 (GRCm39) missense probably benign 0.01
R1487:Trip12 UTSW 1 84,746,352 (GRCm39) missense probably damaging 1.00
R1702:Trip12 UTSW 1 84,722,784 (GRCm39) missense probably damaging 1.00
R1781:Trip12 UTSW 1 84,708,342 (GRCm39) missense probably benign 0.01
R1847:Trip12 UTSW 1 84,726,990 (GRCm39) missense probably damaging 1.00
R1854:Trip12 UTSW 1 84,705,866 (GRCm39) missense probably damaging 1.00
R1866:Trip12 UTSW 1 84,722,781 (GRCm39) missense probably damaging 1.00
R1926:Trip12 UTSW 1 84,727,012 (GRCm39) missense probably damaging 0.98
R1935:Trip12 UTSW 1 84,771,822 (GRCm39) missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84,738,522 (GRCm39) missense probably damaging 1.00
R1994:Trip12 UTSW 1 84,726,893 (GRCm39) missense probably damaging 1.00
R2014:Trip12 UTSW 1 84,738,587 (GRCm39) nonsense probably null
R2391:Trip12 UTSW 1 84,792,511 (GRCm39) frame shift probably null
R2423:Trip12 UTSW 1 84,792,511 (GRCm39) frame shift probably null
R2433:Trip12 UTSW 1 84,721,544 (GRCm39) missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84,732,064 (GRCm39) missense probably benign 0.07
R3040:Trip12 UTSW 1 84,719,966 (GRCm39) missense probably benign 0.13
R3735:Trip12 UTSW 1 84,792,511 (GRCm39) frame shift probably null
R3907:Trip12 UTSW 1 84,709,827 (GRCm39) missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84,703,462 (GRCm39) missense probably damaging 1.00
R4540:Trip12 UTSW 1 84,726,997 (GRCm39) missense probably damaging 0.99
R4859:Trip12 UTSW 1 84,771,531 (GRCm39) missense probably damaging 0.99
R5240:Trip12 UTSW 1 84,771,854 (GRCm39) missense probably benign
R5278:Trip12 UTSW 1 84,739,868 (GRCm39) missense probably damaging 1.00
R5377:Trip12 UTSW 1 84,735,152 (GRCm39) missense probably damaging 1.00
R5510:Trip12 UTSW 1 84,746,401 (GRCm39) missense probably damaging 1.00
R5542:Trip12 UTSW 1 84,727,065 (GRCm39) missense probably damaging 1.00
R5550:Trip12 UTSW 1 84,738,820 (GRCm39) missense probably damaging 0.99
R5886:Trip12 UTSW 1 84,708,179 (GRCm39) intron probably benign
R5893:Trip12 UTSW 1 84,736,884 (GRCm39) unclassified probably benign
R5914:Trip12 UTSW 1 84,741,179 (GRCm39) missense probably damaging 1.00
R5925:Trip12 UTSW 1 84,726,974 (GRCm39) nonsense probably null
R5985:Trip12 UTSW 1 84,703,492 (GRCm39) missense probably damaging 0.99
R6135:Trip12 UTSW 1 84,738,559 (GRCm39) missense probably benign 0.00
R6158:Trip12 UTSW 1 84,738,733 (GRCm39) missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84,771,591 (GRCm39) missense probably damaging 1.00
R6816:Trip12 UTSW 1 84,771,435 (GRCm39) missense probably damaging 0.99
R7144:Trip12 UTSW 1 84,771,435 (GRCm39) missense probably damaging 0.99
R7194:Trip12 UTSW 1 84,771,943 (GRCm39) missense probably benign 0.07
R7355:Trip12 UTSW 1 84,792,604 (GRCm39) missense probably damaging 1.00
R7361:Trip12 UTSW 1 84,728,163 (GRCm39) missense probably damaging 0.98
R7588:Trip12 UTSW 1 84,738,604 (GRCm39) missense probably damaging 0.99
R7705:Trip12 UTSW 1 84,755,170 (GRCm39) missense probably damaging 1.00
R7818:Trip12 UTSW 1 84,738,527 (GRCm39) missense probably damaging 1.00
R7918:Trip12 UTSW 1 84,722,784 (GRCm39) missense probably damaging 0.98
R8127:Trip12 UTSW 1 84,716,463 (GRCm39) missense probably damaging 0.99
R8336:Trip12 UTSW 1 84,743,762 (GRCm39) missense probably benign 0.37
R8373:Trip12 UTSW 1 84,773,488 (GRCm39) missense probably damaging 0.98
R8719:Trip12 UTSW 1 84,722,790 (GRCm39) missense probably damaging 0.98
R8771:Trip12 UTSW 1 84,721,018 (GRCm39) unclassified probably benign
R8997:Trip12 UTSW 1 84,771,596 (GRCm39) missense probably benign 0.10
R9146:Trip12 UTSW 1 84,771,881 (GRCm39) missense possibly damaging 0.89
R9236:Trip12 UTSW 1 84,703,550 (GRCm39) missense probably damaging 1.00
R9338:Trip12 UTSW 1 84,727,019 (GRCm39) missense probably damaging 0.99
R9391:Trip12 UTSW 1 84,773,473 (GRCm39) missense probably benign 0.00
R9516:Trip12 UTSW 1 84,735,215 (GRCm39) missense probably damaging 1.00
X0023:Trip12 UTSW 1 84,738,508 (GRCm39) missense probably benign 0.12
X0065:Trip12 UTSW 1 84,726,884 (GRCm39) missense probably benign 0.21
Z1088:Trip12 UTSW 1 84,743,889 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGTGTTAGTCCTAAATGCTATC -3'
(R):5'- TCCATTTCAGTGAAGTGCAAGAAG -3'

Sequencing Primer
(F):5'- TTGGAATACTGGTTAAAAACACAAAC -3'
(R):5'- CAGTGAAGTGCAAGAAGGAATATTTC -3'
Posted On 2020-07-13