Mutagenetix > Incidental Mutation

Incidental Mutation 'R8221:Trip12'

636667

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8221 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 84766050 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 512 (T512K)

Ref Sequence

ENSEMBL: ENSMUSP00000140267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894]

AlphaFold

G5E870

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027421
AA Change: T512K

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: T512K

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185909

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186465
AA Change: T512K

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: T512K

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186648
AA Change: T506K

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: T506K

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186894
AA Change: T512K

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: T512K

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	3e-20	SMART
PDB:1WA5\|B	447	641	7e-6	PDB
Blast:ARM	476	516	6e-6	BLAST
WWE	764	839	6.9e-25	SMART

Predicted Effect

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	A	G	11: 100,519,750	F134S	probably damaging	Het
Acsl5	T	C	19: 55,268,830		probably null	Het
Adam29	G	T	8: 55,872,428	N330K	probably benign	Het
Adgrv1	A	G	13: 81,528,914	S1933P	probably benign	Het
Afap1l2	T	C	19: 56,914,392	H785R	probably damaging	Het
Ahnak	T	A	19: 9,010,436	L3028*	probably null	Het
Ajuba	T	C	14: 54,570,390	T462A	possibly damaging	Het
Ankrd36	A	G	11: 5,584,016	N289S	possibly damaging	Het
Ankrd46	A	T	15: 36,485,855	L84Q	probably damaging	Het
Ankrd54	T	G	15: 79,056,070	D163A	probably damaging	Het
Arhgef28	A	G	13: 98,145,556	L10P	probably benign	Het
Atm	A	T	9: 53,455,988		probably null	Het
Azin1	G	C	15: 38,492,328	F312L	probably damaging	Het
BC080695	T	G	4: 143,571,960	Y158D	probably benign	Het
C2cd4c	A	G	10: 79,612,648	S222P	probably damaging	Het
Cdyl	A	G	13: 35,816,164	T143A	probably benign	Het
Clhc1	G	A	11: 29,553,751	V56I	possibly damaging	Het
Cntn4	T	C	6: 106,509,510	S300P	probably benign	Het
Col12a1	A	G	9: 79,643,942	Y2131H	probably damaging	Het
Cyp3a41b	A	G	5: 145,569,380	S287P	probably benign	Het
Dctn4	A	G	18: 60,556,329	D424G	probably benign	Het
Dnajb8	C	T	6: 88,222,958	R159C	possibly damaging	Het
Dopey2	A	G	16: 93,749,959	T284A	probably benign	Het
E330034G19Rik	A	C	14: 24,296,067		probably null	Het
Ehhadh	G	A	16: 21,762,623	P540S	possibly damaging	Het
Emsy	T	C	7: 98,647,904	E24G	probably damaging	Het
F930015N05Rik	A	C	11: 64,435,592	L74W	unknown	Het
Fat1	A	G	8: 44,953,353	D1047G		Het
Galnt7	A	G	8: 57,552,566	V211A	possibly damaging	Het
Gdap2	T	C	3: 100,202,295	C543R	unknown	Het
Ghr	A	C	15: 3,333,419	D190E	probably benign	Het
Glrx	A	G	13: 75,847,227	M89V	probably benign	Het
Gm10323	A	C	13: 66,852,795	Y91*	noncoding transcript	Het
Gnb4	A	T	3: 32,590,035	D153E	possibly damaging	Het
Gnptab	G	T	10: 88,440,392		probably null	Het
Grip2	T	C	6: 91,785,684	D193G	possibly damaging	Het
Igsf3	T	C	3: 101,439,722	W658R	probably damaging	Het
Ip6k1	T	A	9: 108,045,916	F416I	probably benign	Het
Klhl1	T	G	14: 96,280,110	T377P	possibly damaging	Het
Lrrc38	G	A	4: 143,350,733	G189R	probably damaging	Het
Lrrfip1	T	C	1: 91,115,156	S428P	probably benign	Het
Megf10	A	G	18: 57,283,821	D754G	probably benign	Het
Mrgprx2	T	A	7: 48,482,779	Y97F	probably benign	Het
Msantd2	T	G	9: 37,489,388	V22G	probably damaging	Het
Myl6b	T	C	10: 128,497,340	K11R	unknown	Het
Nab2	C	A	10: 127,662,776	V475L	probably benign	Het
Npas1	T	C	7: 16,455,965	E552G	probably damaging	Het
Pknox2	T	C	9: 36,909,744	N274S	possibly damaging	Het
Pmepa1	A	T	2: 173,227,907	L247Q	probably damaging	Het
Poll	T	C	19: 45,553,608	K420E	probably damaging	Het
Polr2a	A	G	11: 69,737,518	V1283A	probably benign	Het
Ppil4	A	T	10: 7,795,680	Y36F	probably benign	Het
Psd2	C	T	18: 35,980,425	R317W	probably damaging	Het
Pspc1	T	A	14: 56,778,159	M1L	probably benign	Het
Qrsl1	A	T	10: 43,882,084	F338I	possibly damaging	Het
Rcor3	A	G	1: 192,130,449	Y77H	unknown	Het
Sbno2	G	A	10: 80,070,011	P157L	probably benign	Het
Scn10a	C	T	9: 119,617,763	V1400I	probably damaging	Het
Setd3	C	G	12: 108,107,353	G555A	possibly damaging	Het
Slc12a4	A	T	8: 105,951,969	M245K	probably benign	Het
Slc1a5	T	A	7: 16,781,977	L26Q	probably benign	Het
Slc38a3	T	G	9: 107,657,709	M156L	probably damaging	Het
Slc45a2	A	T	15: 11,001,147	I111F	probably benign	Het
Slc4a3	T	A	1: 75,552,166	M491K	probably benign	Het
Son	A	G	16: 91,656,846	D827G	probably damaging	Het
Sppl2c	A	T	11: 104,186,884	H170L	probably damaging	Het
St6gal2	T	A	17: 55,490,934		probably null	Het
Taf4b	T	A	18: 14,898,049	L830H	probably damaging	Het
Tex22	A	G	12: 113,075,076		probably null	Het
Tiam2	C	T	17: 3,518,585	R1669C	probably damaging	Het
Tmprss15	T	A	16: 79,024,335	N506I	probably damaging	Het
Topors	A	T	4: 40,260,686	I866K	unknown	Het
Ubr1	T	A	2: 120,961,104	H133L	probably damaging	Het
Wwtr1	T	C	3: 57,459,020	D422G	probably damaging	Het
Zfp689	A	C	7: 127,444,586	C291G	probably damaging	Het
Zfyve9	A	G	4: 108,719,680	L68P	possibly damaging	Het
Zswim5	G	T	4: 116,878,022	R188L	probably benign	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGGTGTTAGTCCTAAATGCTATC -3'
(R):5'- TCCATTTCAGTGAAGTGCAAGAAG -3'

Sequencing Primer
(F):5'- TTGGAATACTGGTTAAAAACACAAAC -3'
(R):5'- CAGTGAAGTGCAAGAAGGAATATTTC -3'

Posted On

2020-07-13