Incidental Mutation 'R0718:Vangl2'
ID63667
Institutional Source Beutler Lab
Gene Symbol Vangl2
Ensembl Gene ENSMUSG00000026556
Gene NameVANGL planar cell polarity 2
SynonymsC530001F03Rik, Ltap, loop-tail, Lpp1, strabismus, ska, ska17
MMRRC Submission 038900-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0718 (G1)
Quality Score139
Status Validated
Chromosome1
Chromosomal Location172000960-172028444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 172006217 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 433 (A433V)
Ref Sequence ENSEMBL: ENSMUSP00000106895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027837] [ENSMUST00000111263] [ENSMUST00000111264] [ENSMUST00000138714] [ENSMUST00000153662]
Predicted Effect probably damaging
Transcript: ENSMUST00000027837
AA Change: A393V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027837
Gene: ENSMUSG00000026556
AA Change: A393V

DomainStartEndE-ValueType
Pfam:Strabismus 22 521 3.1e-267 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111263
AA Change: A393V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106894
Gene: ENSMUSG00000026556
AA Change: A393V

DomainStartEndE-ValueType
Pfam:Strabismus 22 521 3.1e-267 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111264
AA Change: A433V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106895
Gene: ENSMUSG00000026556
AA Change: A433V

DomainStartEndE-ValueType
Pfam:Strabismus 19 272 5e-115 PFAM
Pfam:Strabismus 298 560 1.3e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138714
SMART Domains Protein: ENSMUSP00000117736
Gene: ENSMUSG00000026556

DomainStartEndE-ValueType
Pfam:Strabismus 22 102 2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148363
Predicted Effect probably benign
Transcript: ENSMUST00000153662
SMART Domains Protein: ENSMUSP00000116522
Gene: ENSMUSG00000026556

DomainStartEndE-ValueType
Pfam:Strabismus 22 130 2.4e-38 PFAM
Meta Mutation Damage Score 0.4090 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the regulation of planar cell polarity, especially in the stereociliary bundles of the cochlea. The encoded protein transmits directional signals to individual cells or groups of cells in epithelial sheets. This protein is also involved in the development of the neural plate. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous animals do not survive past birth. Developmental defects are seen in the nervous, cardiovascular, skeletal, vestibular, and respiratory systems. Kinked or looped tails are noted in heterozygotes with partial penetrance, along with a head wobble and some nervous system deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,679,608 Y811N possibly damaging Het
Adrm1 T C 2: 180,175,147 probably benign Het
Alms1 T A 6: 85,621,821 S1210T probably benign Het
Ampd3 C T 7: 110,777,808 P11L probably damaging Het
Arhgap5 A G 12: 52,516,507 E87G possibly damaging Het
Armc5 C T 7: 128,240,070 probably benign Het
Asic2 C G 11: 80,971,456 probably benign Het
Asph A G 4: 9,514,683 probably benign Het
Bicd2 T A 13: 49,377,875 probably null Het
Brip1 A G 11: 86,143,305 L530P possibly damaging Het
Bsn G T 9: 108,111,360 probably benign Het
Btnl4 T A 17: 34,469,634 H390L probably benign Het
Ccdc70 A C 8: 21,973,308 K38T probably damaging Het
Ccni G A 5: 93,202,316 P35S probably benign Het
Cdh17 A G 4: 11,810,451 D714G possibly damaging Het
Cenpf A G 1: 189,653,984 L2033P probably damaging Het
Cfap69 A T 5: 5,621,924 M328K probably damaging Het
Cmah T G 13: 24,417,210 probably null Het
Cog6 T C 3: 53,010,629 T163A probably benign Het
Cyp2j8 G A 4: 96,501,196 S130F probably benign Het
Dgki A G 6: 37,012,896 V636A probably damaging Het
Dmkn T A 7: 30,764,786 probably benign Het
Dnah6 A G 6: 73,035,293 I3679T possibly damaging Het
Dsp A T 13: 38,196,764 Y2495F possibly damaging Het
Exosc4 C T 15: 76,329,489 A171V probably benign Het
Fbxw24 A G 9: 109,623,509 probably benign Het
Flvcr1 A T 1: 191,025,582 L171Q probably damaging Het
Fsd1 G T 17: 55,996,445 probably null Het
Gm7732 A G 17: 21,129,844 noncoding transcript Het
H2-K2 A C 17: 33,975,623 noncoding transcript Het
Hgf A G 5: 16,593,859 N295S probably damaging Het
Ift88 T A 14: 57,517,413 D811E probably benign Het
Igsf9b T A 9: 27,323,361 probably null Het
Immt T A 6: 71,863,172 V311E probably damaging Het
Ipo11 T A 13: 106,919,611 N51I possibly damaging Het
Isy1 T C 6: 87,819,176 K260E probably damaging Het
Jchain T G 5: 88,526,202 I28L probably benign Het
Jmjd1c T A 10: 67,218,946 probably null Het
Kif13b T C 14: 64,751,662 probably benign Het
Klhdc7b T C 15: 89,388,169 Y427H possibly damaging Het
Klhl8 T C 5: 103,876,293 probably benign Het
Lrp2 C T 2: 69,510,948 D963N probably damaging Het
Ltbp3 G T 19: 5,746,748 probably benign Het
Ltf C A 9: 111,040,379 Q41K probably benign Het
Med4 T A 14: 73,516,657 I148N probably damaging Het
Mlh3 T G 12: 85,247,697 S1242R possibly damaging Het
Mllt6 T C 11: 97,676,359 probably benign Het
Mpdz A G 4: 81,292,473 I1712T possibly damaging Het
Mrgprb4 T A 7: 48,198,553 H209L probably benign Het
Nkapl A T 13: 21,468,440 M1K probably null Het
Nmur2 T A 11: 56,029,498 probably benign Het
Nsun2 T A 13: 69,543,697 probably benign Het
Olfr1082 G A 2: 86,594,081 T249I probably benign Het
Olfr1130 A G 2: 87,607,927 I180V probably benign Het
Ovgp1 T C 3: 105,974,830 probably benign Het
Pcdh8 A G 14: 79,770,691 V144A possibly damaging Het
Pcnx3 G A 19: 5,677,728 probably benign Het
Pla2r1 C A 2: 60,479,530 V570L possibly damaging Het
Plxnd1 C A 6: 115,966,638 E1202D possibly damaging Het
Ppp1r37 T C 7: 19,532,254 E529G probably benign Het
Prdm15 A G 16: 97,812,633 F496L possibly damaging Het
Prlhr A T 19: 60,468,005 V41D probably benign Het
Prlhr G T 19: 60,468,059 S23* probably null Het
Prpf4 C T 4: 62,414,540 probably benign Het
Psg26 C T 7: 18,475,235 R416H probably benign Het
Psg26 T C 7: 18,478,287 H381R probably benign Het
Ralgds T G 2: 28,549,116 M717R probably benign Het
Rbms1 T C 2: 60,842,412 N44D probably damaging Het
Rpa1 T C 11: 75,318,401 probably benign Het
Rprd2 T C 3: 95,766,387 N568S probably benign Het
Rptor A G 11: 119,872,376 M929V probably benign Het
Rspo1 T A 4: 125,007,149 C97S possibly damaging Het
Scin C T 12: 40,079,607 G396S probably damaging Het
Scn9a T C 2: 66,547,112 N409D probably damaging Het
Sf3b1 A G 1: 55,019,385 I15T probably damaging Het
Sh3bp2 T C 5: 34,555,495 V149A probably damaging Het
Slc39a12 T A 2: 14,407,426 probably benign Het
Sp9 G T 2: 73,273,827 A242S possibly damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tatdn3 G T 1: 191,052,849 probably benign Het
Tex14 G A 11: 87,499,613 V379I probably benign Het
Tmed6 T C 8: 107,061,724 N197S probably damaging Het
Ttbk2 G A 2: 120,748,575 L689F probably benign Het
Ttbk2 A T 2: 120,745,160 I1043N probably benign Het
Ttn A G 2: 76,810,696 S5283P probably damaging Het
Ube3b C A 5: 114,402,555 S441* probably null Het
Ush2a G A 1: 188,797,830 C3272Y probably damaging Het
Vac14 T A 8: 110,632,477 I95K probably damaging Het
Vwa5b1 A T 4: 138,608,824 V153D probably damaging Het
Zfhx3 T A 8: 108,955,650 D3240E unknown Het
Zfp945 A G 17: 22,851,030 C632R probably damaging Het
Zfyve26 G A 12: 79,265,802 probably benign Het
Zyg11b A T 4: 108,242,076 I606N possibly damaging Het
Other mutations in Vangl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03117:Vangl2 APN 1 172012848 missense probably damaging 1.00
crimp UTSW 1 172006127 missense probably damaging 1.00
Piggy UTSW 1 172009663 missense possibly damaging 0.95
R0594:Vangl2 UTSW 1 172004657 missense probably damaging 1.00
R1162:Vangl2 UTSW 1 172004847 missense probably damaging 1.00
R1173:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1174:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1175:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1857:Vangl2 UTSW 1 172009897 missense probably damaging 0.99
R2290:Vangl2 UTSW 1 172008546 nonsense probably null
R2421:Vangl2 UTSW 1 172007959 missense probably damaging 1.00
R4024:Vangl2 UTSW 1 172008041 missense probably benign 0.00
R4809:Vangl2 UTSW 1 172009663 missense possibly damaging 0.95
R4980:Vangl2 UTSW 1 172009565 missense probably damaging 1.00
R5761:Vangl2 UTSW 1 172006127 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCTGCACAGACAAGACAGATGG -3'
(R):5'- GCAGCAGTCAGAGCCAGTGG -3'

Sequencing Primer
(F):5'- tcctacaaaatccaattcccaac -3'
(R):5'- TCAGAGCCAGTGGGTAGAG -3'
Posted On2013-07-30