Incidental Mutation 'R8221:Galnt7'
ID 636692
Institutional Source Beutler Lab
Gene Symbol Galnt7
Ensembl Gene ENSMUSG00000031608
Gene Name polypeptide N-acetylgalactosaminyltransferase 7
Synonyms ppGaNTase-T7
MMRRC Submission 067639-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.830) question?
Stock # R8221 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 57976862-58106066 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58005600 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 211 (V211A)
Ref Sequence ENSEMBL: ENSMUSP00000034021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]
AlphaFold Q80VA0
Predicted Effect possibly damaging
Transcript: ENSMUST00000034021
AA Change: V211A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608
AA Change: V211A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 3e-28 PFAM
Pfam:Glyco_tranf_2_2 210 490 2e-7 PFAM
Pfam:Glyco_transf_7C 375 445 1.8e-8 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110316
AA Change: V211A

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608
AA Change: V211A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 8.2e-27 PFAM
Pfam:Glyco_tranf_2_2 210 490 1.3e-7 PFAM
Pfam:Glyco_transf_7C 369 445 9.3e-9 PFAM
RICIN 531 652 3.39e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A G 11: 100,410,576 (GRCm39) F134S probably damaging Het
Acsl5 T C 19: 55,257,262 (GRCm39) probably null Het
Adam29 G T 8: 56,325,463 (GRCm39) N330K probably benign Het
Adgrv1 A G 13: 81,677,033 (GRCm39) S1933P probably benign Het
Afap1l2 T C 19: 56,902,824 (GRCm39) H785R probably damaging Het
Ahnak T A 19: 8,987,800 (GRCm39) L3028* probably null Het
Ajuba T C 14: 54,807,847 (GRCm39) T462A possibly damaging Het
Ankrd36 A G 11: 5,534,016 (GRCm39) N289S possibly damaging Het
Ankrd46 A T 15: 36,486,001 (GRCm39) L84Q probably damaging Het
Ankrd54 T G 15: 78,940,270 (GRCm39) D163A probably damaging Het
Arhgef28 A G 13: 98,282,064 (GRCm39) L10P probably benign Het
Atm A T 9: 53,367,288 (GRCm39) probably null Het
Azin1 G C 15: 38,492,572 (GRCm39) F312L probably damaging Het
C2cd4c A G 10: 79,448,482 (GRCm39) S222P probably damaging Het
Cdyl A G 13: 36,000,147 (GRCm39) T143A probably benign Het
Clhc1 G A 11: 29,503,751 (GRCm39) V56I possibly damaging Het
Cntn4 T C 6: 106,486,471 (GRCm39) S300P probably benign Het
Col12a1 A G 9: 79,551,224 (GRCm39) Y2131H probably damaging Het
Cyp3a41b A G 5: 145,506,190 (GRCm39) S287P probably benign Het
Dctn4 A G 18: 60,689,401 (GRCm39) D424G probably benign Het
Dnajb8 C T 6: 88,199,940 (GRCm39) R159C possibly damaging Het
Dop1b A G 16: 93,546,847 (GRCm39) T284A probably benign Het
E330034G19Rik A C 14: 24,346,135 (GRCm39) probably null Het
Ehhadh G A 16: 21,581,373 (GRCm39) P540S possibly damaging Het
Emsy T C 7: 98,297,111 (GRCm39) E24G probably damaging Het
F930015N05Rik A C 11: 64,326,418 (GRCm39) L74W unknown Het
Fat1 A G 8: 45,406,390 (GRCm39) D1047G Het
Gdap2 T C 3: 100,109,611 (GRCm39) C543R unknown Het
Ghr A C 15: 3,362,901 (GRCm39) D190E probably benign Het
Glrx A G 13: 75,995,346 (GRCm39) M89V probably benign Het
Gm10323 A C 13: 67,000,859 (GRCm39) Y91* noncoding transcript Het
Gnb4 A T 3: 32,644,184 (GRCm39) D153E possibly damaging Het
Gnptab G T 10: 88,276,254 (GRCm39) probably null Het
Grip2 T C 6: 91,762,665 (GRCm39) D193G possibly damaging Het
Igsf3 T C 3: 101,347,038 (GRCm39) W658R probably damaging Het
Ip6k1 T A 9: 107,923,115 (GRCm39) F416I probably benign Het
Klhl1 T G 14: 96,517,546 (GRCm39) T377P possibly damaging Het
Lrrc38 G A 4: 143,077,303 (GRCm39) G189R probably damaging Het
Lrrfip1 T C 1: 91,042,878 (GRCm39) S428P probably benign Het
Megf10 A G 18: 57,416,893 (GRCm39) D754G probably benign Het
Mrgprx2 T A 7: 48,132,527 (GRCm39) Y97F probably benign Het
Msantd2 T G 9: 37,400,684 (GRCm39) V22G probably damaging Het
Myl6b T C 10: 128,333,209 (GRCm39) K11R unknown Het
Nab2 C A 10: 127,498,645 (GRCm39) V475L probably benign Het
Npas1 T C 7: 16,189,890 (GRCm39) E552G probably damaging Het
Pknox2 T C 9: 36,821,040 (GRCm39) N274S possibly damaging Het
Pmepa1 A T 2: 173,069,700 (GRCm39) L247Q probably damaging Het
Poll T C 19: 45,542,047 (GRCm39) K420E probably damaging Het
Polr2a A G 11: 69,628,344 (GRCm39) V1283A probably benign Het
Ppil4 A T 10: 7,671,444 (GRCm39) Y36F probably benign Het
Pramel20 T G 4: 143,298,530 (GRCm39) Y158D probably benign Het
Psd2 C T 18: 36,113,478 (GRCm39) R317W probably damaging Het
Pspc1 T A 14: 57,015,616 (GRCm39) M1L probably benign Het
Qrsl1 A T 10: 43,758,080 (GRCm39) F338I possibly damaging Het
Rcor3 A G 1: 191,814,749 (GRCm39) Y77H unknown Het
Sbno2 G A 10: 79,905,845 (GRCm39) P157L probably benign Het
Scn10a C T 9: 119,446,829 (GRCm39) V1400I probably damaging Het
Setd3 C G 12: 108,073,612 (GRCm39) G555A possibly damaging Het
Slc12a4 A T 8: 106,678,601 (GRCm39) M245K probably benign Het
Slc1a5 T A 7: 16,515,902 (GRCm39) L26Q probably benign Het
Slc38a3 T G 9: 107,534,908 (GRCm39) M156L probably damaging Het
Slc45a2 A T 15: 11,001,233 (GRCm39) I111F probably benign Het
Slc4a3 T A 1: 75,528,810 (GRCm39) M491K probably benign Het
Son A G 16: 91,453,734 (GRCm39) D827G probably damaging Het
Sppl2c A T 11: 104,077,710 (GRCm39) H170L probably damaging Het
St6gal2 T A 17: 55,797,935 (GRCm39) probably null Het
Taf4b T A 18: 15,031,106 (GRCm39) L830H probably damaging Het
Tex22 A G 12: 113,038,696 (GRCm39) probably null Het
Tiam2 C T 17: 3,568,860 (GRCm39) R1669C probably damaging Het
Tmprss15 T A 16: 78,821,223 (GRCm39) N506I probably damaging Het
Topors A T 4: 40,260,686 (GRCm39) I866K unknown Het
Trip12 G T 1: 84,743,771 (GRCm39) T512K possibly damaging Het
Ubr1 T A 2: 120,791,585 (GRCm39) H133L probably damaging Het
Wwtr1 T C 3: 57,366,441 (GRCm39) D422G probably damaging Het
Zfp689 A C 7: 127,043,758 (GRCm39) C291G probably damaging Het
Zfyve9 A G 4: 108,576,877 (GRCm39) L68P possibly damaging Het
Zswim5 G T 4: 116,735,219 (GRCm39) R188L probably benign Het
Other mutations in Galnt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Galnt7 APN 8 57,993,073 (GRCm39) missense probably damaging 1.00
IGL00538:Galnt7 APN 8 58,005,556 (GRCm39) missense possibly damaging 0.95
IGL00826:Galnt7 APN 8 57,993,105 (GRCm39) nonsense probably null
IGL00951:Galnt7 APN 8 58,036,858 (GRCm39) missense probably damaging 0.96
IGL01662:Galnt7 APN 8 57,984,769 (GRCm39) splice site probably benign
IGL02280:Galnt7 APN 8 57,989,824 (GRCm39) missense probably damaging 1.00
IGL02832:Galnt7 APN 8 58,005,531 (GRCm39) missense probably damaging 1.00
IGL02936:Galnt7 APN 8 58,037,248 (GRCm39) missense probably benign
IGL03083:Galnt7 APN 8 57,979,223 (GRCm39) missense probably damaging 0.98
IGL03387:Galnt7 APN 8 57,979,212 (GRCm39) missense probably benign 0.01
R0400:Galnt7 UTSW 8 58,037,023 (GRCm39) missense probably damaging 0.99
R0553:Galnt7 UTSW 8 58,005,464 (GRCm39) splice site probably benign
R1463:Galnt7 UTSW 8 58,105,892 (GRCm39) missense probably benign
R1487:Galnt7 UTSW 8 57,993,073 (GRCm39) missense probably damaging 1.00
R1791:Galnt7 UTSW 8 57,995,564 (GRCm39) missense probably benign 0.05
R1817:Galnt7 UTSW 8 57,991,212 (GRCm39) missense probably damaging 1.00
R1962:Galnt7 UTSW 8 57,985,748 (GRCm39) missense probably benign 0.13
R3855:Galnt7 UTSW 8 57,985,658 (GRCm39) splice site probably benign
R3856:Galnt7 UTSW 8 57,985,658 (GRCm39) splice site probably benign
R4232:Galnt7 UTSW 8 58,106,000 (GRCm39) missense probably benign
R4396:Galnt7 UTSW 8 57,991,215 (GRCm39) missense probably damaging 1.00
R4426:Galnt7 UTSW 8 58,005,606 (GRCm39) nonsense probably null
R4610:Galnt7 UTSW 8 57,998,803 (GRCm39) missense probably damaging 0.99
R4745:Galnt7 UTSW 8 57,995,761 (GRCm39) intron probably benign
R4794:Galnt7 UTSW 8 57,998,397 (GRCm39) missense probably damaging 1.00
R5014:Galnt7 UTSW 8 57,998,414 (GRCm39) missense probably damaging 1.00
R5177:Galnt7 UTSW 8 58,037,061 (GRCm39) missense possibly damaging 0.87
R5682:Galnt7 UTSW 8 58,036,967 (GRCm39) nonsense probably null
R6122:Galnt7 UTSW 8 57,979,200 (GRCm39) missense probably damaging 0.99
R6276:Galnt7 UTSW 8 57,989,612 (GRCm39) splice site probably null
R6684:Galnt7 UTSW 8 57,991,143 (GRCm39) missense probably benign 0.16
R6752:Galnt7 UTSW 8 58,105,985 (GRCm39) missense probably damaging 1.00
R7464:Galnt7 UTSW 8 58,037,054 (GRCm39) missense possibly damaging 0.95
R7491:Galnt7 UTSW 8 58,005,552 (GRCm39) missense probably damaging 0.97
R7547:Galnt7 UTSW 8 58,036,996 (GRCm39) missense possibly damaging 0.48
R8093:Galnt7 UTSW 8 57,985,739 (GRCm39) missense probably benign 0.00
R8248:Galnt7 UTSW 8 57,991,222 (GRCm39) missense probably benign 0.34
R8402:Galnt7 UTSW 8 57,995,953 (GRCm39) missense probably damaging 0.98
R8779:Galnt7 UTSW 8 58,037,245 (GRCm39) missense probably benign
R8894:Galnt7 UTSW 8 57,979,176 (GRCm39) nonsense probably null
R8974:Galnt7 UTSW 8 58,105,934 (GRCm39) missense
R9106:Galnt7 UTSW 8 57,985,729 (GRCm39) missense probably damaging 1.00
R9297:Galnt7 UTSW 8 57,995,555 (GRCm39) missense probably damaging 0.98
X0050:Galnt7 UTSW 8 58,005,478 (GRCm39) frame shift probably null
X0062:Galnt7 UTSW 8 58,036,942 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAACTCATGGATTTGGATCTAACG -3'
(R):5'- TCTGCTGAGATCCAAAGAGC -3'

Sequencing Primer
(F):5'- GGGTCTCTGAGTCTCCTGTATAAAAC -3'
(R):5'- GCTGAGATCCAAAGAGCTTCATACTG -3'
Posted On 2020-07-13