Mutagenetix > Incidental Mutation

Incidental Mutation 'R8221:Gnptab'

636704

Institutional Source

Beutler Lab

Gene Symbol

Gnptab

Ensembl Gene

ENSMUSG00000035311

Gene Name

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

Synonyms

EG432486

MMRRC Submission

067639-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.940) question?

Stock #

R8221 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88379132-88447329 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 88440392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000020251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]

AlphaFold

Q69ZN6

Predicted Effect

probably null
Transcript: ENSMUST00000020251

SMART Domains

Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Stealth_CR1	73	101	6.6e-14	PFAM
Pfam:Stealth_CR2	322	429	8.8e-49	PFAM
NL	431	469	3.82e-7	SMART
low complexity region	480	490	N/A	INTRINSIC
NL	498	536	2.37e-2	SMART
DMAP_binding	699	813	6.14e-38	SMART
Pfam:Stealth_CR3	934	982	2.9e-21	PFAM
Pfam:Stealth_CR4	1117	1173	7.9e-28	PFAM
transmembrane domain	1192	1214	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151273

SMART Domains

Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	A	G	11: 100,519,750	F134S	probably damaging	Het
Acsl5	T	C	19: 55,268,830		probably null	Het
Adam29	G	T	8: 55,872,428	N330K	probably benign	Het
Adgrv1	A	G	13: 81,528,914	S1933P	probably benign	Het
Afap1l2	T	C	19: 56,914,392	H785R	probably damaging	Het
Ahnak	T	A	19: 9,010,436	L3028*	probably null	Het
Ajuba	T	C	14: 54,570,390	T462A	possibly damaging	Het
Ankrd36	A	G	11: 5,584,016	N289S	possibly damaging	Het
Ankrd46	A	T	15: 36,485,855	L84Q	probably damaging	Het
Ankrd54	T	G	15: 79,056,070	D163A	probably damaging	Het
Arhgef28	A	G	13: 98,145,556	L10P	probably benign	Het
Atm	A	T	9: 53,455,988		probably null	Het
Azin1	G	C	15: 38,492,328	F312L	probably damaging	Het
BC080695	T	G	4: 143,571,960	Y158D	probably benign	Het
C2cd4c	A	G	10: 79,612,648	S222P	probably damaging	Het
Cdyl	A	G	13: 35,816,164	T143A	probably benign	Het
Clhc1	G	A	11: 29,553,751	V56I	possibly damaging	Het
Cntn4	T	C	6: 106,509,510	S300P	probably benign	Het
Col12a1	A	G	9: 79,643,942	Y2131H	probably damaging	Het
Cyp3a41b	A	G	5: 145,569,380	S287P	probably benign	Het
Dctn4	A	G	18: 60,556,329	D424G	probably benign	Het
Dnajb8	C	T	6: 88,222,958	R159C	possibly damaging	Het
Dopey2	A	G	16: 93,749,959	T284A	probably benign	Het
E330034G19Rik	A	C	14: 24,296,067		probably null	Het
Ehhadh	G	A	16: 21,762,623	P540S	possibly damaging	Het
Emsy	T	C	7: 98,647,904	E24G	probably damaging	Het
F930015N05Rik	A	C	11: 64,435,592	L74W	unknown	Het
Fat1	A	G	8: 44,953,353	D1047G		Het
Galnt7	A	G	8: 57,552,566	V211A	possibly damaging	Het
Gdap2	T	C	3: 100,202,295	C543R	unknown	Het
Ghr	A	C	15: 3,333,419	D190E	probably benign	Het
Glrx	A	G	13: 75,847,227	M89V	probably benign	Het
Gm10323	A	C	13: 66,852,795	Y91*	noncoding transcript	Het
Gnb4	A	T	3: 32,590,035	D153E	possibly damaging	Het
Grip2	T	C	6: 91,785,684	D193G	possibly damaging	Het
Igsf3	T	C	3: 101,439,722	W658R	probably damaging	Het
Ip6k1	T	A	9: 108,045,916	F416I	probably benign	Het
Klhl1	T	G	14: 96,280,110	T377P	possibly damaging	Het
Lrrc38	G	A	4: 143,350,733	G189R	probably damaging	Het
Lrrfip1	T	C	1: 91,115,156	S428P	probably benign	Het
Megf10	A	G	18: 57,283,821	D754G	probably benign	Het
Mrgprx2	T	A	7: 48,482,779	Y97F	probably benign	Het
Msantd2	T	G	9: 37,489,388	V22G	probably damaging	Het
Myl6b	T	C	10: 128,497,340	K11R	unknown	Het
Nab2	C	A	10: 127,662,776	V475L	probably benign	Het
Npas1	T	C	7: 16,455,965	E552G	probably damaging	Het
Pknox2	T	C	9: 36,909,744	N274S	possibly damaging	Het
Pmepa1	A	T	2: 173,227,907	L247Q	probably damaging	Het
Poll	T	C	19: 45,553,608	K420E	probably damaging	Het
Polr2a	A	G	11: 69,737,518	V1283A	probably benign	Het
Ppil4	A	T	10: 7,795,680	Y36F	probably benign	Het
Psd2	C	T	18: 35,980,425	R317W	probably damaging	Het
Pspc1	T	A	14: 56,778,159	M1L	probably benign	Het
Qrsl1	A	T	10: 43,882,084	F338I	possibly damaging	Het
Rcor3	A	G	1: 192,130,449	Y77H	unknown	Het
Sbno2	G	A	10: 80,070,011	P157L	probably benign	Het
Scn10a	C	T	9: 119,617,763	V1400I	probably damaging	Het
Setd3	C	G	12: 108,107,353	G555A	possibly damaging	Het
Slc12a4	A	T	8: 105,951,969	M245K	probably benign	Het
Slc1a5	T	A	7: 16,781,977	L26Q	probably benign	Het
Slc38a3	T	G	9: 107,657,709	M156L	probably damaging	Het
Slc45a2	A	T	15: 11,001,147	I111F	probably benign	Het
Slc4a3	T	A	1: 75,552,166	M491K	probably benign	Het
Son	A	G	16: 91,656,846	D827G	probably damaging	Het
Sppl2c	A	T	11: 104,186,884	H170L	probably damaging	Het
St6gal2	T	A	17: 55,490,934		probably null	Het
Taf4b	T	A	18: 14,898,049	L830H	probably damaging	Het
Tex22	A	G	12: 113,075,076		probably null	Het
Tiam2	C	T	17: 3,518,585	R1669C	probably damaging	Het
Tmprss15	T	A	16: 79,024,335	N506I	probably damaging	Het
Topors	A	T	4: 40,260,686	I866K	unknown	Het
Trip12	G	T	1: 84,766,050	T512K	possibly damaging	Het
Ubr1	T	A	2: 120,961,104	H133L	probably damaging	Het
Wwtr1	T	C	3: 57,459,020	D422G	probably damaging	Het
Zfp689	A	C	7: 127,444,586	C291G	probably damaging	Het
Zfyve9	A	G	4: 108,719,680	L68P	possibly damaging	Het
Zswim5	G	T	4: 116,878,022	R188L	probably benign	Het

Other mutations in Gnptab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Gnptab	APN	10	88433065	missense	probably damaging	0.99
IGL01346:Gnptab	APN	10	88436179	missense	possibly damaging	0.65
IGL01626:Gnptab	APN	10	88437495	missense	probably damaging	0.98
IGL01642:Gnptab	APN	10	88436132	missense	possibly damaging	0.89
IGL02121:Gnptab	APN	10	88429461	missense	possibly damaging	0.90
IGL03076:Gnptab	APN	10	88440289	missense	possibly damaging	0.91
IGL03130:Gnptab	APN	10	88436371	missense	possibly damaging	0.95
maze	UTSW	10	88432573	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0114:Gnptab	UTSW	10	88433400	missense	possibly damaging	0.48
R0206:Gnptab	UTSW	10	88439510	missense	probably damaging	0.98
R0288:Gnptab	UTSW	10	88433105	missense	probably benign	0.00
R0329:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0330:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0369:Gnptab	UTSW	10	88433594	missense	possibly damaging	0.87
R0385:Gnptab	UTSW	10	88436525	missense	probably damaging	1.00
R0522:Gnptab	UTSW	10	88431466	splice site	probably benign
R0569:Gnptab	UTSW	10	88428557	missense	possibly damaging	0.89
R0671:Gnptab	UTSW	10	88443304	splice site	probably benign
R0834:Gnptab	UTSW	10	88429952	missense	probably damaging	1.00
R1375:Gnptab	UTSW	10	88432573	missense	probably damaging	1.00
R1443:Gnptab	UTSW	10	88434081	missense	probably damaging	1.00
R1464:Gnptab	UTSW	10	88445754	splice site	probably benign
R1471:Gnptab	UTSW	10	88445763	missense	probably benign
R1570:Gnptab	UTSW	10	88419454	missense	probably damaging	0.99
R1612:Gnptab	UTSW	10	88428482	splice site	probably null
R1614:Gnptab	UTSW	10	88414589	missense	probably benign
R1638:Gnptab	UTSW	10	88436167	missense	possibly damaging	0.94
R1739:Gnptab	UTSW	10	88436095	missense	probably benign	0.14
R1894:Gnptab	UTSW	10	88419127	missense	possibly damaging	0.69
R2092:Gnptab	UTSW	10	88440305	nonsense	probably null
R2118:Gnptab	UTSW	10	88436398	missense	probably benign	0.13
R2144:Gnptab	UTSW	10	88428506	missense	possibly damaging	0.89
R2174:Gnptab	UTSW	10	88434044	missense	probably damaging	1.00
R3847:Gnptab	UTSW	10	88433577	nonsense	probably null
R3943:Gnptab	UTSW	10	88433894	missense	probably benign
R4434:Gnptab	UTSW	10	88412622	missense	probably damaging	1.00
R4545:Gnptab	UTSW	10	88414595	missense	probably benign	0.00
R4776:Gnptab	UTSW	10	88436528	missense	probably damaging	1.00
R4786:Gnptab	UTSW	10	88436182	missense	probably damaging	1.00
R4880:Gnptab	UTSW	10	88432551	nonsense	probably null
R4889:Gnptab	UTSW	10	88433913	missense	probably benign	0.00
R4923:Gnptab	UTSW	10	88429623	missense	probably benign	0.17
R5694:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R5943:Gnptab	UTSW	10	88433514	missense	probably benign	0.00
R6027:Gnptab	UTSW	10	88433225	missense	probably damaging	0.98
R6074:Gnptab	UTSW	10	88433078	missense	probably damaging	1.00
R6119:Gnptab	UTSW	10	88431395	missense	probably damaging	1.00
R6182:Gnptab	UTSW	10	88429480	missense	possibly damaging	0.71
R6757:Gnptab	UTSW	10	88437502	missense	probably damaging	0.98
R6910:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R6911:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R7094:Gnptab	UTSW	10	88379504	missense	possibly damaging	0.66
R7101:Gnptab	UTSW	10	88440312	missense	probably benign	0.19
R7164:Gnptab	UTSW	10	88434070	nonsense	probably null
R7214:Gnptab	UTSW	10	88379157	unclassified	probably benign
R7316:Gnptab	UTSW	10	88400710	missense	probably damaging	1.00
R7463:Gnptab	UTSW	10	88431389	missense	probably damaging	1.00
R7596:Gnptab	UTSW	10	88443370	missense	probably damaging	0.99
R7654:Gnptab	UTSW	10	88445819	missense	possibly damaging	0.63
R7722:Gnptab	UTSW	10	88379528	missense	probably damaging	0.99
R7770:Gnptab	UTSW	10	88411920	missense	probably benign	0.41
R7791:Gnptab	UTSW	10	88440222	critical splice acceptor site	probably null
R7838:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8002:Gnptab	UTSW	10	88440268	missense	probably benign	0.14
R8168:Gnptab	UTSW	10	88419133	missense	probably benign	0.41
R8219:Gnptab	UTSW	10	88433792	missense	probably benign
R8313:Gnptab	UTSW	10	88439209	missense	probably damaging	1.00
R8351:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R8487:Gnptab	UTSW	10	88432646	critical splice donor site	probably null
R9108:Gnptab	UTSW	10	88433538	missense
R9352:Gnptab	UTSW	10	88432488	missense	probably benign	0.05
R9489:Gnptab	UTSW	10	88433130	missense	probably damaging	1.00
R9598:Gnptab	UTSW	10	88412014	missense	probably damaging	0.97
R9760:Gnptab	UTSW	10	88431448	missense	probably damaging	1.00
R9771:Gnptab	UTSW	10	88432623	missense	probably damaging	1.00
X0064:Gnptab	UTSW	10	88436530	missense	probably damaging	1.00
X0066:Gnptab	UTSW	10	88412011	missense	probably damaging	0.99
Z1176:Gnptab	UTSW	10	88431368	missense	probably damaging	1.00
Z1177:Gnptab	UTSW	10	88440270	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACCGCTAACTCCCTGTTG -3'
(R):5'- ACAGCTGATTAAATGAAGCGTCATG -3'

Sequencing Primer
(F):5'- CGCTAACTCCCTGTTGTTTCAG -3'
(R):5'- TTTCAAATCTCTCGAAATGCCC -3'

Posted On

2020-07-13