Incidental Mutation 'R8221:Clhc1'
ID636708
Institutional Source Beutler Lab
Gene Symbol Clhc1
Ensembl Gene ENSMUSG00000020461
Gene Nameclathrin heavy chain linker domain containing 1
Synonyms1700034F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8221 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location29547950-29578367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29553751 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 56 (V56I)
Ref Sequence ENSEMBL: ENSMUSP00000020753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020753] [ENSMUST00000208530]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020753
AA Change: V56I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020753
Gene: ENSMUSG00000020461
AA Change: V56I

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 28 152 2.6e-26 PFAM
Pfam:Clathrin_H_link 302 365 3.7e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208530
AA Change: V56I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.0890 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A G 11: 100,519,750 F134S probably damaging Het
Acsl5 T C 19: 55,268,830 probably null Het
Adam29 G T 8: 55,872,428 N330K probably benign Het
Adgrv1 A G 13: 81,528,914 S1933P probably benign Het
Afap1l2 T C 19: 56,914,392 H785R probably damaging Het
Ahnak T A 19: 9,010,436 L3028* probably null Het
Ajuba T C 14: 54,570,390 T462A possibly damaging Het
Ankrd36 A G 11: 5,584,016 N289S possibly damaging Het
Ankrd46 A T 15: 36,485,855 L84Q probably damaging Het
Ankrd54 T G 15: 79,056,070 D163A probably damaging Het
Arhgef28 A G 13: 98,145,556 L10P probably benign Het
Atm A T 9: 53,455,988 probably null Het
Azin1 G C 15: 38,492,328 F312L probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
C2cd4c A G 10: 79,612,648 S222P probably damaging Het
Cdyl A G 13: 35,816,164 T143A probably benign Het
Cntn4 T C 6: 106,509,510 S300P probably benign Het
Col12a1 A G 9: 79,643,942 Y2131H probably damaging Het
Cyp3a41b A G 5: 145,569,380 S287P probably benign Het
Dctn4 A G 18: 60,556,329 D424G probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dopey2 A G 16: 93,749,959 T284A probably benign Het
E330034G19Rik A C 14: 24,296,067 probably null Het
Ehhadh G A 16: 21,762,623 P540S possibly damaging Het
Emsy T C 7: 98,647,904 E24G probably damaging Het
F930015N05Rik A C 11: 64,435,592 L74W unknown Het
Fat1 A G 8: 44,953,353 D1047G Het
Galnt7 A G 8: 57,552,566 V211A possibly damaging Het
Gdap2 T C 3: 100,202,295 C543R unknown Het
Ghr A C 15: 3,333,419 D190E probably benign Het
Glrx A G 13: 75,847,227 M89V probably benign Het
Gm10323 A C 13: 66,852,795 Y91* noncoding transcript Het
Gnb4 A T 3: 32,590,035 D153E possibly damaging Het
Gnptab G T 10: 88,440,392 probably null Het
Grip2 T C 6: 91,785,684 D193G possibly damaging Het
Igsf3 T C 3: 101,439,722 W658R probably damaging Het
Ip6k1 T A 9: 108,045,916 F416I probably benign Het
Klhl1 T G 14: 96,280,110 T377P possibly damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lrrfip1 T C 1: 91,115,156 S428P probably benign Het
Megf10 A G 18: 57,283,821 D754G probably benign Het
Mrgprx2 T A 7: 48,482,779 Y97F probably benign Het
Msantd2 T G 9: 37,489,388 V22G probably damaging Het
Myl6b T C 10: 128,497,340 K11R unknown Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Npas1 T C 7: 16,455,965 E552G probably damaging Het
Pknox2 T C 9: 36,909,744 N274S possibly damaging Het
Pmepa1 A T 2: 173,227,907 L247Q probably damaging Het
Poll T C 19: 45,553,608 K420E probably damaging Het
Polr2a A G 11: 69,737,518 V1283A probably benign Het
Ppil4 A T 10: 7,795,680 Y36F probably benign Het
Psd2 C T 18: 35,980,425 R317W probably damaging Het
Pspc1 T A 14: 56,778,159 M1L probably benign Het
Qrsl1 A T 10: 43,882,084 F338I possibly damaging Het
Rcor3 A G 1: 192,130,449 Y77H unknown Het
Sbno2 G A 10: 80,070,011 P157L probably benign Het
Scn10a C T 9: 119,617,763 V1400I probably damaging Het
Setd3 C G 12: 108,107,353 G555A possibly damaging Het
Slc12a4 A T 8: 105,951,969 M245K probably benign Het
Slc1a5 T A 7: 16,781,977 L26Q probably benign Het
Slc38a3 T G 9: 107,657,709 M156L probably damaging Het
Slc45a2 A T 15: 11,001,147 I111F probably benign Het
Slc4a3 T A 1: 75,552,166 M491K probably benign Het
Son A G 16: 91,656,846 D827G probably damaging Het
Sppl2c A T 11: 104,186,884 H170L probably damaging Het
St6gal2 T A 17: 55,490,934 probably null Het
Taf4b T A 18: 14,898,049 L830H probably damaging Het
Tex22 A G 12: 113,075,076 probably null Het
Tiam2 C T 17: 3,518,585 R1669C probably damaging Het
Tmprss15 T A 16: 79,024,335 N506I probably damaging Het
Topors A T 4: 40,260,686 I866K unknown Het
Trip12 G T 1: 84,766,050 T512K possibly damaging Het
Ubr1 T A 2: 120,961,104 H133L probably damaging Het
Wwtr1 T C 3: 57,459,020 D422G probably damaging Het
Zfp689 A C 7: 127,444,586 C291G probably damaging Het
Zfyve9 A G 4: 108,719,680 L68P possibly damaging Het
Zswim5 G T 4: 116,878,022 R188L probably benign Het
Other mutations in Clhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Clhc1 APN 11 29571745 missense probably damaging 0.99
IGL00976:Clhc1 APN 11 29561389 missense probably benign 0.43
IGL01826:Clhc1 APN 11 29553765 splice site probably null
IGL02029:Clhc1 APN 11 29560798 missense probably benign 0.01
IGL02479:Clhc1 APN 11 29578107 missense probably damaging 0.98
R0553:Clhc1 UTSW 11 29561366 splice site probably benign
R1313:Clhc1 UTSW 11 29571678 missense probably benign
R1313:Clhc1 UTSW 11 29571678 missense probably benign
R1482:Clhc1 UTSW 11 29553725 missense probably damaging 1.00
R1624:Clhc1 UTSW 11 29569287 missense possibly damaging 0.85
R1742:Clhc1 UTSW 11 29557647 splice site probably null
R2094:Clhc1 UTSW 11 29557771 missense probably benign 0.13
R2130:Clhc1 UTSW 11 29557663 missense probably benign 0.33
R2237:Clhc1 UTSW 11 29569329 missense probably benign 0.30
R3814:Clhc1 UTSW 11 29571826 missense possibly damaging 0.57
R3854:Clhc1 UTSW 11 29571789 missense probably damaging 1.00
R4417:Clhc1 UTSW 11 29571826 missense possibly damaging 0.57
R4659:Clhc1 UTSW 11 29578229 makesense probably null
R5021:Clhc1 UTSW 11 29560627 missense probably benign 0.01
R5246:Clhc1 UTSW 11 29575434 missense probably damaging 1.00
R5287:Clhc1 UTSW 11 29578244 utr 3 prime probably benign
R5657:Clhc1 UTSW 11 29561431 missense probably benign 0.03
R5771:Clhc1 UTSW 11 29563854 missense possibly damaging 0.94
R6050:Clhc1 UTSW 11 29561397 missense possibly damaging 0.76
R6211:Clhc1 UTSW 11 29578145 missense probably damaging 1.00
R6500:Clhc1 UTSW 11 29560542 missense possibly damaging 0.87
R6615:Clhc1 UTSW 11 29578149 missense possibly damaging 0.75
R6944:Clhc1 UTSW 11 29569346 missense probably damaging 0.97
R7252:Clhc1 UTSW 11 29563937 missense probably benign 0.01
R7860:Clhc1 UTSW 11 29557651 critical splice acceptor site probably null
R8259:Clhc1 UTSW 11 29553746 missense probably benign 0.37
R8769:Clhc1 UTSW 11 29561401 missense probably damaging 0.99
R8931:Clhc1 UTSW 11 29560533 nonsense probably null
X0023:Clhc1 UTSW 11 29569305 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCGGTGAACAAGCTTACAG -3'
(R):5'- AGCCTAACTAGTCATCAGGAAATG -3'

Sequencing Primer
(F):5'- TCCGGTGAACAAGCTTACAGATTAAG -3'
(R):5'- GGAAATGTAAATTCTGCACTTGAGC -3'
Posted On2020-07-13