Incidental Mutation 'R8221:Son'
ID636729
Institutional Source Beutler Lab
Gene Symbol Son
Ensembl Gene ENSMUSG00000022961
Gene NameSon DNA binding protein
Synonyms2900011L12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R8221 (G1)
Quality Score169.009
Status Validated
Chromosome16
Chromosomal Location91647506-91679221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91656846 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 827 (D827G)
Ref Sequence ENSEMBL: ENSMUSP00000109671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]
Predicted Effect probably damaging
Transcript: ENSMUST00000114036
AA Change: D827G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: D827G

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.65e-7 PROSPERO
internal_repeat_2 214 362 6.55e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.65e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.55e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114037
AA Change: D827G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: D827G

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117633
AA Change: D827G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: D827G

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119368
AA Change: D827G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: D827G

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.22e-7 PROSPERO
internal_repeat_2 214 362 8.67e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.22e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 8.67e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140312
AA Change: D827G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: D827G

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147891
SMART Domains Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
Pfam:RSRP 61 358 2.9e-13 PFAM
low complexity region 466 477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A G 11: 100,519,750 F134S probably damaging Het
Acsl5 T C 19: 55,268,830 probably null Het
Adam29 G T 8: 55,872,428 N330K probably benign Het
Adgrv1 A G 13: 81,528,914 S1933P probably benign Het
Afap1l2 T C 19: 56,914,392 H785R probably damaging Het
Ahnak T A 19: 9,010,436 L3028* probably null Het
Ajuba T C 14: 54,570,390 T462A possibly damaging Het
Ankrd36 A G 11: 5,584,016 N289S possibly damaging Het
Ankrd46 A T 15: 36,485,855 L84Q probably damaging Het
Ankrd54 T G 15: 79,056,070 D163A probably damaging Het
Arhgef28 A G 13: 98,145,556 L10P probably benign Het
Atm A T 9: 53,455,988 probably null Het
Azin1 G C 15: 38,492,328 F312L probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
C2cd4c A G 10: 79,612,648 S222P probably damaging Het
Cdyl A G 13: 35,816,164 T143A probably benign Het
Clhc1 G A 11: 29,553,751 V56I possibly damaging Het
Cntn4 T C 6: 106,509,510 S300P probably benign Het
Col12a1 A G 9: 79,643,942 Y2131H probably damaging Het
Cyp3a41b A G 5: 145,569,380 S287P probably benign Het
Dctn4 A G 18: 60,556,329 D424G probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dopey2 A G 16: 93,749,959 T284A probably benign Het
E330034G19Rik A C 14: 24,296,067 probably null Het
Ehhadh G A 16: 21,762,623 P540S possibly damaging Het
Emsy T C 7: 98,647,904 E24G probably damaging Het
F930015N05Rik A C 11: 64,435,592 L74W unknown Het
Fat1 A G 8: 44,953,353 D1047G Het
Galnt7 A G 8: 57,552,566 V211A possibly damaging Het
Gdap2 T C 3: 100,202,295 C543R unknown Het
Ghr A C 15: 3,333,419 D190E probably benign Het
Glrx A G 13: 75,847,227 M89V probably benign Het
Gm10323 A C 13: 66,852,795 Y91* noncoding transcript Het
Gnb4 A T 3: 32,590,035 D153E possibly damaging Het
Gnptab G T 10: 88,440,392 probably null Het
Grip2 T C 6: 91,785,684 D193G possibly damaging Het
Igsf3 T C 3: 101,439,722 W658R probably damaging Het
Ip6k1 T A 9: 108,045,916 F416I probably benign Het
Klhl1 T G 14: 96,280,110 T377P possibly damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lrrfip1 T C 1: 91,115,156 S428P probably benign Het
Megf10 A G 18: 57,283,821 D754G probably benign Het
Mrgprx2 T A 7: 48,482,779 Y97F probably benign Het
Msantd2 T G 9: 37,489,388 V22G probably damaging Het
Myl6b T C 10: 128,497,340 K11R unknown Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Npas1 T C 7: 16,455,965 E552G probably damaging Het
Pknox2 T C 9: 36,909,744 N274S possibly damaging Het
Pmepa1 A T 2: 173,227,907 L247Q probably damaging Het
Poll T C 19: 45,553,608 K420E probably damaging Het
Polr2a A G 11: 69,737,518 V1283A probably benign Het
Ppil4 A T 10: 7,795,680 Y36F probably benign Het
Psd2 C T 18: 35,980,425 R317W probably damaging Het
Pspc1 T A 14: 56,778,159 M1L probably benign Het
Qrsl1 A T 10: 43,882,084 F338I possibly damaging Het
Rcor3 A G 1: 192,130,449 Y77H unknown Het
Sbno2 G A 10: 80,070,011 P157L probably benign Het
Scn10a C T 9: 119,617,763 V1400I probably damaging Het
Setd3 C G 12: 108,107,353 G555A possibly damaging Het
Slc12a4 A T 8: 105,951,969 M245K probably benign Het
Slc1a5 T A 7: 16,781,977 L26Q probably benign Het
Slc38a3 T G 9: 107,657,709 M156L probably damaging Het
Slc45a2 A T 15: 11,001,147 I111F probably benign Het
Slc4a3 T A 1: 75,552,166 M491K probably benign Het
Sppl2c A T 11: 104,186,884 H170L probably damaging Het
St6gal2 T A 17: 55,490,934 probably null Het
Taf4b T A 18: 14,898,049 L830H probably damaging Het
Tex22 A G 12: 113,075,076 probably null Het
Tiam2 C T 17: 3,518,585 R1669C probably damaging Het
Tmprss15 T A 16: 79,024,335 N506I probably damaging Het
Topors A T 4: 40,260,686 I866K unknown Het
Trip12 G T 1: 84,766,050 T512K possibly damaging Het
Ubr1 T A 2: 120,961,104 H133L probably damaging Het
Wwtr1 T C 3: 57,459,020 D422G probably damaging Het
Zfp689 A C 7: 127,444,586 C291G probably damaging Het
Zfyve9 A G 4: 108,719,680 L68P possibly damaging Het
Zswim5 G T 4: 116,878,022 R188L probably benign Het
Other mutations in Son
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Son APN 16 91664322 missense probably damaging 0.99
IGL01024:Son APN 16 91655910 missense probably damaging 1.00
IGL01066:Son APN 16 91660136 intron probably benign
IGL01083:Son APN 16 91657391 missense probably damaging 1.00
IGL01115:Son APN 16 91659458 missense probably benign 0.31
IGL01467:Son APN 16 91657277 missense possibly damaging 0.93
IGL01506:Son APN 16 91657286 missense possibly damaging 0.67
IGL01933:Son APN 16 91658015 missense probably benign 0.00
IGL02156:Son APN 16 91656104 missense possibly damaging 0.93
IGL02473:Son APN 16 91658795 missense probably damaging 0.99
IGL02498:Son APN 16 91656825 missense probably damaging 0.99
IGL02517:Son APN 16 91655211 missense possibly damaging 0.92
IGL02530:Son APN 16 91658471 missense possibly damaging 0.50
IGL02865:Son APN 16 91651752 missense probably damaging 1.00
IGL03180:Son APN 16 91657008 missense probably damaging 1.00
R0013:Son UTSW 16 91651662 missense probably damaging 1.00
R0036:Son UTSW 16 91660166 intron probably benign
R0037:Son UTSW 16 91664728 missense probably damaging 1.00
R0041:Son UTSW 16 91659333 missense probably damaging 1.00
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0056:Son UTSW 16 91678155 missense possibly damaging 0.86
R0227:Son UTSW 16 91656873 missense probably damaging 0.99
R0256:Son UTSW 16 91656584 missense possibly damaging 0.95
R0302:Son UTSW 16 91656144 missense probably damaging 1.00
R0815:Son UTSW 16 91655484 missense probably damaging 0.98
R1225:Son UTSW 16 91657340 missense probably damaging 1.00
R1255:Son UTSW 16 91664695 missense probably damaging 1.00
R1457:Son UTSW 16 91657086 missense probably damaging 1.00
R1459:Son UTSW 16 91655342 missense possibly damaging 0.93
R1535:Son UTSW 16 91659734 missense probably damaging 0.99
R1587:Son UTSW 16 91659718 missense probably damaging 1.00
R1605:Son UTSW 16 91657664 missense probably damaging 1.00
R1629:Son UTSW 16 91657622 missense probably damaging 1.00
R1711:Son UTSW 16 91660226 intron probably benign
R2138:Son UTSW 16 91659372 missense possibly damaging 0.95
R2245:Son UTSW 16 91647960 splice site probably null
R2351:Son UTSW 16 91657659 missense probably damaging 0.98
R2434:Son UTSW 16 91654687 missense probably damaging 1.00
R2870:Son UTSW 16 91664317 splice site probably null
R2871:Son UTSW 16 91664317 splice site probably null
R2872:Son UTSW 16 91664317 splice site probably null
R2889:Son UTSW 16 91659899 unclassified probably benign
R3712:Son UTSW 16 91656726 missense probably damaging 0.99
R3913:Son UTSW 16 91660111 intron probably benign
R4172:Son UTSW 16 91659362 missense probably damaging 1.00
R4301:Son UTSW 16 91658411 missense possibly damaging 0.53
R4302:Son UTSW 16 91658411 missense possibly damaging 0.53
R4770:Son UTSW 16 91658868 missense probably damaging 0.96
R4881:Son UTSW 16 91675509 missense probably benign 0.31
R5020:Son UTSW 16 91656375 missense probably damaging 1.00
R5032:Son UTSW 16 91657664 missense probably damaging 1.00
R5151:Son UTSW 16 91655699 missense probably damaging 1.00
R5153:Son UTSW 16 91655022 missense possibly damaging 0.86
R5215:Son UTSW 16 91656675 missense probably damaging 0.99
R5243:Son UTSW 16 91654733 missense probably damaging 1.00
R5354:Son UTSW 16 91655739 missense probably damaging 0.99
R5529:Son UTSW 16 91655466 missense probably damaging 1.00
R5696:Son UTSW 16 91671413 missense possibly damaging 0.67
R5763:Son UTSW 16 91657490 missense probably damaging 1.00
R5766:Son UTSW 16 91664987 intron probably benign
R5788:Son UTSW 16 91660052 intron probably benign
R5992:Son UTSW 16 91658904 missense probably benign 0.04
R6314:Son UTSW 16 91660410 intron probably benign
R6371:Son UTSW 16 91674741
R6429:Son UTSW 16 91658166 missense probably benign 0.33
R6451:Son UTSW 16 91657602 missense probably damaging 0.99
R6489:Son UTSW 16 91655156 missense possibly damaging 0.70
R6513:Son UTSW 16 91659947 intron probably benign
R6753:Son UTSW 16 91657188 missense probably damaging 0.99
R6916:Son UTSW 16 91654785 missense probably damaging 0.97
R7070:Son UTSW 16 91656841 unclassified probably benign
R7079:Son UTSW 16 91656841 unclassified probably benign
R7110:Son UTSW 16 91656518 missense probably benign 0.01
R7120:Son UTSW 16 91656691 unclassified probably benign
R7120:Son UTSW 16 91670526 missense unknown
R7167:Son UTSW 16 91660334 small deletion probably benign
R7205:Son UTSW 16 91660295 small deletion probably benign
R7208:Son UTSW 16 91662102 missense unknown
R7219:Son UTSW 16 91665001 missense unknown
R7249:Son UTSW 16 91660334 small deletion probably benign
R7328:Son UTSW 16 91658390 missense probably benign 0.33
R7330:Son UTSW 16 91656598 unclassified probably benign
R7374:Son UTSW 16 91660334 small deletion probably benign
R7405:Son UTSW 16 91656691 unclassified probably benign
R7420:Son UTSW 16 91660334 small deletion probably benign
R7424:Son UTSW 16 91660334 small deletion probably benign
R7464:Son UTSW 16 91656691 unclassified probably benign
R7514:Son UTSW 16 91654860 missense probably damaging 0.99
R7555:Son UTSW 16 91658922 missense probably damaging 0.99
R7645:Son UTSW 16 91660295 small deletion probably benign
R7716:Son UTSW 16 91656691 unclassified probably benign
R7718:Son UTSW 16 91660334 small deletion probably benign
R7778:Son UTSW 16 91656528 missense probably damaging 0.99
R7824:Son UTSW 16 91656528 missense probably damaging 0.99
R7856:Son UTSW 16 91659258 missense probably damaging 0.99
R7870:Son UTSW 16 91656598 unclassified probably benign
R7928:Son UTSW 16 91656841 unclassified probably benign
R7972:Son UTSW 16 91660334 small deletion probably benign
R7978:Son UTSW 16 91660334 small deletion probably benign
R8000:Son UTSW 16 91660334 small deletion probably benign
R8192:Son UTSW 16 91655549 missense possibly damaging 0.91
R8227:Son UTSW 16 91656691 unclassified probably benign
R8233:Son UTSW 16 91660334 small deletion probably benign
R8255:Son UTSW 16 91664936 missense unknown
R8292:Son UTSW 16 91656657 missense possibly damaging 0.93
R8407:Son UTSW 16 91660334 small deletion probably benign
R8468:Son UTSW 16 91656691 unclassified probably benign
R8495:Son UTSW 16 91660295 small deletion probably benign
R8726:Son UTSW 16 91656691 unclassified probably benign
R8772:Son UTSW 16 91657938 missense possibly damaging 0.65
R8796:Son UTSW 16 91660334 small deletion probably benign
R8862:Son UTSW 16 91656846 missense probably damaging 1.00
R8962:Son UTSW 16 91658169 missense possibly damaging 0.91
RF007:Son UTSW 16 91659369 missense possibly damaging 0.53
RF041:Son UTSW 16 91656691 unclassified probably benign
Z1176:Son UTSW 16 91655801 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGGACTCCCAGATGTTAGCAAC -3'
(R):5'- AGCAGAATCCTGGGTACTAGATGC -3'

Sequencing Primer
(F):5'- GCAACTAGCACCATGGACTC -3'
(R):5'- TTGGGCATCCATAGTACCAGATGC -3'
Posted On2020-07-13