Incidental Mutation 'R8221:Tiam2'
ID636731
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8221 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3518585 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1669 (R1669C)
Ref Sequence ENSEMBL: ENSMUSP00000072020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041003] [ENSMUST00000072156] [ENSMUST00000169838]
PDB Structure Crystal structure of the Tiam2 PHCCEx domain [X-RAY DIFFRACTION]
Low-resolution crystal structure of the Tiam2 PHCCEx domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000041003
SMART Domains Protein: ENSMUSP00000035291
Gene: ENSMUSG00000036983

DomainStartEndE-ValueType
rADc 43 234 5.56e-69 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000072156
AA Change: R1669C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: R1669C

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169838
AA Change: R1669C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: R1669C

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A G 11: 100,519,750 F134S probably damaging Het
Acsl5 T C 19: 55,268,830 probably null Het
Adam29 G T 8: 55,872,428 N330K probably benign Het
Adgrv1 A G 13: 81,528,914 S1933P probably benign Het
Afap1l2 T C 19: 56,914,392 H785R probably damaging Het
Ahnak T A 19: 9,010,436 L3028* probably null Het
Ajuba T C 14: 54,570,390 T462A possibly damaging Het
Ankrd36 A G 11: 5,584,016 N289S possibly damaging Het
Ankrd46 A T 15: 36,485,855 L84Q probably damaging Het
Ankrd54 T G 15: 79,056,070 D163A probably damaging Het
Arhgef28 A G 13: 98,145,556 L10P probably benign Het
Atm A T 9: 53,455,988 probably null Het
Azin1 G C 15: 38,492,328 F312L probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
C2cd4c A G 10: 79,612,648 S222P probably damaging Het
Cdyl A G 13: 35,816,164 T143A probably benign Het
Clhc1 G A 11: 29,553,751 V56I possibly damaging Het
Cntn4 T C 6: 106,509,510 S300P probably benign Het
Col12a1 A G 9: 79,643,942 Y2131H probably damaging Het
Cyp3a41b A G 5: 145,569,380 S287P probably benign Het
Dctn4 A G 18: 60,556,329 D424G probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dopey2 A G 16: 93,749,959 T284A probably benign Het
E330034G19Rik A C 14: 24,296,067 probably null Het
Ehhadh G A 16: 21,762,623 P540S possibly damaging Het
Emsy T C 7: 98,647,904 E24G probably damaging Het
F930015N05Rik A C 11: 64,435,592 L74W unknown Het
Fat1 A G 8: 44,953,353 D1047G Het
Galnt7 A G 8: 57,552,566 V211A possibly damaging Het
Gdap2 T C 3: 100,202,295 C543R unknown Het
Ghr A C 15: 3,333,419 D190E probably benign Het
Glrx A G 13: 75,847,227 M89V probably benign Het
Gm10323 A C 13: 66,852,795 Y91* noncoding transcript Het
Gnb4 A T 3: 32,590,035 D153E possibly damaging Het
Gnptab G T 10: 88,440,392 probably null Het
Grip2 T C 6: 91,785,684 D193G possibly damaging Het
Igsf3 T C 3: 101,439,722 W658R probably damaging Het
Ip6k1 T A 9: 108,045,916 F416I probably benign Het
Klhl1 T G 14: 96,280,110 T377P possibly damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lrrfip1 T C 1: 91,115,156 S428P probably benign Het
Megf10 A G 18: 57,283,821 D754G probably benign Het
Mrgprx2 T A 7: 48,482,779 Y97F probably benign Het
Msantd2 T G 9: 37,489,388 V22G probably damaging Het
Myl6b T C 10: 128,497,340 K11R unknown Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Npas1 T C 7: 16,455,965 E552G probably damaging Het
Pknox2 T C 9: 36,909,744 N274S possibly damaging Het
Pmepa1 A T 2: 173,227,907 L247Q probably damaging Het
Poll T C 19: 45,553,608 K420E probably damaging Het
Polr2a A G 11: 69,737,518 V1283A probably benign Het
Ppil4 A T 10: 7,795,680 Y36F probably benign Het
Psd2 C T 18: 35,980,425 R317W probably damaging Het
Pspc1 T A 14: 56,778,159 M1L probably benign Het
Qrsl1 A T 10: 43,882,084 F338I possibly damaging Het
Rcor3 A G 1: 192,130,449 Y77H unknown Het
Sbno2 G A 10: 80,070,011 P157L probably benign Het
Scn10a C T 9: 119,617,763 V1400I probably damaging Het
Setd3 C G 12: 108,107,353 G555A possibly damaging Het
Slc12a4 A T 8: 105,951,969 M245K probably benign Het
Slc1a5 T A 7: 16,781,977 L26Q probably benign Het
Slc38a3 T G 9: 107,657,709 M156L probably damaging Het
Slc45a2 A T 15: 11,001,147 I111F probably benign Het
Slc4a3 T A 1: 75,552,166 M491K probably benign Het
Son A G 16: 91,656,846 D827G probably damaging Het
Sppl2c A T 11: 104,186,884 H170L probably damaging Het
St6gal2 T A 17: 55,490,934 probably null Het
Taf4b T A 18: 14,898,049 L830H probably damaging Het
Tex22 A G 12: 113,075,076 probably null Het
Tmprss15 T A 16: 79,024,335 N506I probably damaging Het
Topors A T 4: 40,260,686 I866K unknown Het
Trip12 G T 1: 84,766,050 T512K possibly damaging Het
Ubr1 T A 2: 120,961,104 H133L probably damaging Het
Wwtr1 T C 3: 57,459,020 D422G probably damaging Het
Zfp689 A C 7: 127,444,586 C291G probably damaging Het
Zfyve9 A G 4: 108,719,680 L68P possibly damaging Het
Zswim5 G T 4: 116,878,022 R188L probably benign Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3448385 missense probably benign 0.36
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3503008 missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R7989:Tiam2 UTSW 17 3518249 nonsense probably null
R8011:Tiam2 UTSW 17 3448396 missense possibly damaging 0.92
R8260:Tiam2 UTSW 17 3518319 missense possibly damaging 0.94
R8292:Tiam2 UTSW 17 3506867 missense probably benign 0.01
R8406:Tiam2 UTSW 17 3507790 missense possibly damaging 0.94
R8424:Tiam2 UTSW 17 3516041 missense probably damaging 1.00
R8424:Tiam2 UTSW 17 3516042 missense probably damaging 1.00
R8430:Tiam2 UTSW 17 3518262 missense probably benign 0.05
R8530:Tiam2 UTSW 17 3450812 missense probably benign 0.03
R8692:Tiam2 UTSW 17 3428807 missense probably damaging 1.00
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 splice site probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Z1176:Tiam2 UTSW 17 3505776 missense probably null 1.00
Z1177:Tiam2 UTSW 17 3427263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGATGAGGACTTCCACCAC -3'
(R):5'- TGAGCATTGTAAGCACACTACAC -3'

Sequencing Primer
(F):5'- GACATTGAGATTCAGTTCCAGAGAC -3'
(R):5'- TTGTAAGCACACTACACAAATCATG -3'
Posted On2020-07-13