Incidental Mutation 'R8221:Taf4b'
ID 636732
Institutional Source Beutler Lab
Gene Symbol Taf4b
Ensembl Gene ENSMUSG00000054321
Gene Name TATA-box binding protein associated factor 4b
Synonyms Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock # R8221 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 14783245-14900359 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14898049 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 830 (L830H)
Ref Sequence ENSEMBL: ENSMUSP00000126909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169862]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000169862
AA Change: L830H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: L830H

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Pfam:TAFH 257 348 5.3e-39 PFAM
low complexity region 359 376 N/A INTRINSIC
low complexity region 412 422 N/A INTRINSIC
Pfam:TAF4 610 852 4e-72 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A G 11: 100,519,750 F134S probably damaging Het
Acsl5 T C 19: 55,268,830 probably null Het
Adam29 G T 8: 55,872,428 N330K probably benign Het
Adgrv1 A G 13: 81,528,914 S1933P probably benign Het
Afap1l2 T C 19: 56,914,392 H785R probably damaging Het
Ahnak T A 19: 9,010,436 L3028* probably null Het
Ajuba T C 14: 54,570,390 T462A possibly damaging Het
Ankrd36 A G 11: 5,584,016 N289S possibly damaging Het
Ankrd46 A T 15: 36,485,855 L84Q probably damaging Het
Ankrd54 T G 15: 79,056,070 D163A probably damaging Het
Arhgef28 A G 13: 98,145,556 L10P probably benign Het
Atm A T 9: 53,455,988 probably null Het
Azin1 G C 15: 38,492,328 F312L probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
C2cd4c A G 10: 79,612,648 S222P probably damaging Het
Cdyl A G 13: 35,816,164 T143A probably benign Het
Clhc1 G A 11: 29,553,751 V56I possibly damaging Het
Cntn4 T C 6: 106,509,510 S300P probably benign Het
Col12a1 A G 9: 79,643,942 Y2131H probably damaging Het
Cyp3a41b A G 5: 145,569,380 S287P probably benign Het
Dctn4 A G 18: 60,556,329 D424G probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dopey2 A G 16: 93,749,959 T284A probably benign Het
E330034G19Rik A C 14: 24,296,067 probably null Het
Ehhadh G A 16: 21,762,623 P540S possibly damaging Het
Emsy T C 7: 98,647,904 E24G probably damaging Het
F930015N05Rik A C 11: 64,435,592 L74W unknown Het
Fat1 A G 8: 44,953,353 D1047G Het
Galnt7 A G 8: 57,552,566 V211A possibly damaging Het
Gdap2 T C 3: 100,202,295 C543R unknown Het
Ghr A C 15: 3,333,419 D190E probably benign Het
Glrx A G 13: 75,847,227 M89V probably benign Het
Gm10323 A C 13: 66,852,795 Y91* noncoding transcript Het
Gnb4 A T 3: 32,590,035 D153E possibly damaging Het
Gnptab G T 10: 88,440,392 probably null Het
Grip2 T C 6: 91,785,684 D193G possibly damaging Het
Igsf3 T C 3: 101,439,722 W658R probably damaging Het
Ip6k1 T A 9: 108,045,916 F416I probably benign Het
Klhl1 T G 14: 96,280,110 T377P possibly damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lrrfip1 T C 1: 91,115,156 S428P probably benign Het
Megf10 A G 18: 57,283,821 D754G probably benign Het
Mrgprx2 T A 7: 48,482,779 Y97F probably benign Het
Msantd2 T G 9: 37,489,388 V22G probably damaging Het
Myl6b T C 10: 128,497,340 K11R unknown Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Npas1 T C 7: 16,455,965 E552G probably damaging Het
Pknox2 T C 9: 36,909,744 N274S possibly damaging Het
Pmepa1 A T 2: 173,227,907 L247Q probably damaging Het
Poll T C 19: 45,553,608 K420E probably damaging Het
Polr2a A G 11: 69,737,518 V1283A probably benign Het
Ppil4 A T 10: 7,795,680 Y36F probably benign Het
Psd2 C T 18: 35,980,425 R317W probably damaging Het
Pspc1 T A 14: 56,778,159 M1L probably benign Het
Qrsl1 A T 10: 43,882,084 F338I possibly damaging Het
Rcor3 A G 1: 192,130,449 Y77H unknown Het
Sbno2 G A 10: 80,070,011 P157L probably benign Het
Scn10a C T 9: 119,617,763 V1400I probably damaging Het
Setd3 C G 12: 108,107,353 G555A possibly damaging Het
Slc12a4 A T 8: 105,951,969 M245K probably benign Het
Slc1a5 T A 7: 16,781,977 L26Q probably benign Het
Slc38a3 T G 9: 107,657,709 M156L probably damaging Het
Slc45a2 A T 15: 11,001,147 I111F probably benign Het
Slc4a3 T A 1: 75,552,166 M491K probably benign Het
Son A G 16: 91,656,846 D827G probably damaging Het
Sppl2c A T 11: 104,186,884 H170L probably damaging Het
St6gal2 T A 17: 55,490,934 probably null Het
Tex22 A G 12: 113,075,076 probably null Het
Tiam2 C T 17: 3,518,585 R1669C probably damaging Het
Tmprss15 T A 16: 79,024,335 N506I probably damaging Het
Topors A T 4: 40,260,686 I866K unknown Het
Trip12 G T 1: 84,766,050 T512K possibly damaging Het
Ubr1 T A 2: 120,961,104 H133L probably damaging Het
Wwtr1 T C 3: 57,459,020 D422G probably damaging Het
Zfp689 A C 7: 127,444,586 C291G probably damaging Het
Zfyve9 A G 4: 108,719,680 L68P possibly damaging Het
Zswim5 G T 4: 116,878,022 R188L probably benign Het
Other mutations in Taf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Taf4b APN 18 14844420 missense probably damaging 1.00
IGL01755:Taf4b APN 18 14897985 missense probably benign
IGL01755:Taf4b APN 18 14897986 missense probably benign 0.13
IGL02049:Taf4b APN 18 14830139 missense probably benign 0.00
IGL02650:Taf4b APN 18 14841983 nonsense probably null
IGL03078:Taf4b APN 18 14813554 missense possibly damaging 0.48
IGL03169:Taf4b APN 18 14821535 missense probably damaging 1.00
IGL03261:Taf4b APN 18 14821528 missense probably benign
adirondack UTSW 18 14804578 missense probably null 0.16
R0266:Taf4b UTSW 18 14813077 splice site probably benign
R0385:Taf4b UTSW 18 14783760 missense probably benign 0.00
R1015:Taf4b UTSW 18 14813098 missense probably damaging 1.00
R1054:Taf4b UTSW 18 14821473 missense probably benign 0.00
R1416:Taf4b UTSW 18 14821427 splice site probably benign
R1435:Taf4b UTSW 18 14807409 missense probably damaging 1.00
R1609:Taf4b UTSW 18 14835881 missense probably damaging 1.00
R1611:Taf4b UTSW 18 14844469 missense probably null 1.00
R1906:Taf4b UTSW 18 14822102 missense probably benign 0.00
R2038:Taf4b UTSW 18 14807399 missense probably damaging 1.00
R2890:Taf4b UTSW 18 14804792 missense probably damaging 1.00
R4527:Taf4b UTSW 18 14821442 missense probably damaging 1.00
R4559:Taf4b UTSW 18 14813526 missense probably damaging 1.00
R4773:Taf4b UTSW 18 14804520 missense probably benign 0.30
R4857:Taf4b UTSW 18 14804578 missense probably null 0.16
R4946:Taf4b UTSW 18 14813542 missense probably damaging 1.00
R4984:Taf4b UTSW 18 14835816 missense probably damaging 1.00
R4994:Taf4b UTSW 18 14898043 missense probably damaging 0.99
R5010:Taf4b UTSW 18 14822172 missense possibly damaging 0.59
R5155:Taf4b UTSW 18 14830095 missense probably benign 0.07
R5874:Taf4b UTSW 18 14804554 missense probably benign
R6079:Taf4b UTSW 18 14822198 missense possibly damaging 0.75
R6303:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6304:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6372:Taf4b UTSW 18 14804733 missense probably damaging 1.00
R6972:Taf4b UTSW 18 14813347 missense possibly damaging 0.86
R7538:Taf4b UTSW 18 14813545 missense probably damaging 1.00
R7790:Taf4b UTSW 18 14813274 missense probably damaging 1.00
R8021:Taf4b UTSW 18 14804524 missense probably damaging 1.00
R8072:Taf4b UTSW 18 14821528 missense probably benign
R8075:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8145:Taf4b UTSW 18 14830028 missense probably damaging 1.00
R8320:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8509:Taf4b UTSW 18 14898055 missense probably damaging 1.00
R8535:Taf4b UTSW 18 14822138 missense probably damaging 0.99
R8772:Taf4b UTSW 18 14835852 missense probably damaging 1.00
R8805:Taf4b UTSW 18 14813428 missense possibly damaging 0.65
R8874:Taf4b UTSW 18 14830070 missense probably benign 0.39
R9155:Taf4b UTSW 18 14813239 missense probably benign 0.00
R9254:Taf4b UTSW 18 14813374 missense probably damaging 0.98
R9338:Taf4b UTSW 18 14821498 missense probably benign 0.00
R9379:Taf4b UTSW 18 14813374 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATACCTTCCCAATGGACAGTGC -3'
(R):5'- AGACGTAGCAAAAGCTTGTCAG -3'

Sequencing Primer
(F):5'- CAATGGACAGTGCCACGTG -3'
(R):5'- CAGTGTAAGCAGTGGTCTTCCATAC -3'
Posted On 2020-07-13