Mutagenetix > Incidental Mutations

Incidental Mutation 'R8221:Taf4b'

636732

Institutional Source

Beutler Lab

Gene Symbol

Taf4b

Ensembl Gene

ENSMUSG00000054321

Gene Name

TATA-box binding protein associated factor 4b

Synonyms

Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.342) question?

Stock #

R8221 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14783245-14900359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14898049 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 830 (L830H)

Ref Sequence

ENSEMBL: ENSMUSP00000126909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169862]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000169862
AA Change: L830H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: L830H

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	185	196	N/A	INTRINSIC
Pfam:TAFH	257	348	5.3e-39	PFAM
low complexity region	359	376	N/A	INTRINSIC
low complexity region	412	422	N/A	INTRINSIC
Pfam:TAF4	610	852	4e-72	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	A	G	11: 100,519,750	F134S	probably damaging	Het
Acsl5	T	C	19: 55,268,830		probably null	Het
Adam29	G	T	8: 55,872,428	N330K	probably benign	Het
Adgrv1	A	G	13: 81,528,914	S1933P	probably benign	Het
Afap1l2	T	C	19: 56,914,392	H785R	probably damaging	Het
Ahnak	T	A	19: 9,010,436	L3028*	probably null	Het
Ajuba	T	C	14: 54,570,390	T462A	possibly damaging	Het
Ankrd36	A	G	11: 5,584,016	N289S	possibly damaging	Het
Ankrd46	A	T	15: 36,485,855	L84Q	probably damaging	Het
Ankrd54	T	G	15: 79,056,070	D163A	probably damaging	Het
Arhgef28	A	G	13: 98,145,556	L10P	probably benign	Het
Atm	A	T	9: 53,455,988		probably null	Het
Azin1	G	C	15: 38,492,328	F312L	probably damaging	Het
BC080695	T	G	4: 143,571,960	Y158D	probably benign	Het
C2cd4c	A	G	10: 79,612,648	S222P	probably damaging	Het
Cdyl	A	G	13: 35,816,164	T143A	probably benign	Het
Clhc1	G	A	11: 29,553,751	V56I	possibly damaging	Het
Cntn4	T	C	6: 106,509,510	S300P	probably benign	Het
Col12a1	A	G	9: 79,643,942	Y2131H	probably damaging	Het
Cyp3a41b	A	G	5: 145,569,380	S287P	probably benign	Het
Dctn4	A	G	18: 60,556,329	D424G	probably benign	Het
Dnajb8	C	T	6: 88,222,958	R159C	possibly damaging	Het
Dopey2	A	G	16: 93,749,959	T284A	probably benign	Het
E330034G19Rik	A	C	14: 24,296,067		probably null	Het
Ehhadh	G	A	16: 21,762,623	P540S	possibly damaging	Het
Emsy	T	C	7: 98,647,904	E24G	probably damaging	Het
F930015N05Rik	A	C	11: 64,435,592	L74W	unknown	Het
Fat1	A	G	8: 44,953,353	D1047G		Het
Galnt7	A	G	8: 57,552,566	V211A	possibly damaging	Het
Gdap2	T	C	3: 100,202,295	C543R	unknown	Het
Ghr	A	C	15: 3,333,419	D190E	probably benign	Het
Glrx	A	G	13: 75,847,227	M89V	probably benign	Het
Gm10323	A	C	13: 66,852,795	Y91*	noncoding transcript	Het
Gnb4	A	T	3: 32,590,035	D153E	possibly damaging	Het
Gnptab	G	T	10: 88,440,392		probably null	Het
Grip2	T	C	6: 91,785,684	D193G	possibly damaging	Het
Igsf3	T	C	3: 101,439,722	W658R	probably damaging	Het
Ip6k1	T	A	9: 108,045,916	F416I	probably benign	Het
Klhl1	T	G	14: 96,280,110	T377P	possibly damaging	Het
Lrrc38	G	A	4: 143,350,733	G189R	probably damaging	Het
Lrrfip1	T	C	1: 91,115,156	S428P	probably benign	Het
Megf10	A	G	18: 57,283,821	D754G	probably benign	Het
Mrgprx2	T	A	7: 48,482,779	Y97F	probably benign	Het
Msantd2	T	G	9: 37,489,388	V22G	probably damaging	Het
Myl6b	T	C	10: 128,497,340	K11R	unknown	Het
Nab2	C	A	10: 127,662,776	V475L	probably benign	Het
Npas1	T	C	7: 16,455,965	E552G	probably damaging	Het
Pknox2	T	C	9: 36,909,744	N274S	possibly damaging	Het
Pmepa1	A	T	2: 173,227,907	L247Q	probably damaging	Het
Poll	T	C	19: 45,553,608	K420E	probably damaging	Het
Polr2a	A	G	11: 69,737,518	V1283A	probably benign	Het
Ppil4	A	T	10: 7,795,680	Y36F	probably benign	Het
Psd2	C	T	18: 35,980,425	R317W	probably damaging	Het
Pspc1	T	A	14: 56,778,159	M1L	probably benign	Het
Qrsl1	A	T	10: 43,882,084	F338I	possibly damaging	Het
Rcor3	A	G	1: 192,130,449	Y77H	unknown	Het
Sbno2	G	A	10: 80,070,011	P157L	probably benign	Het
Scn10a	C	T	9: 119,617,763	V1400I	probably damaging	Het
Setd3	C	G	12: 108,107,353	G555A	possibly damaging	Het
Slc12a4	A	T	8: 105,951,969	M245K	probably benign	Het
Slc1a5	T	A	7: 16,781,977	L26Q	probably benign	Het
Slc38a3	T	G	9: 107,657,709	M156L	probably damaging	Het
Slc45a2	A	T	15: 11,001,147	I111F	probably benign	Het
Slc4a3	T	A	1: 75,552,166	M491K	probably benign	Het
Son	A	G	16: 91,656,846	D827G	probably damaging	Het
Sppl2c	A	T	11: 104,186,884	H170L	probably damaging	Het
St6gal2	T	A	17: 55,490,934		probably null	Het
Tex22	A	G	12: 113,075,076		probably null	Het
Tiam2	C	T	17: 3,518,585	R1669C	probably damaging	Het
Tmprss15	T	A	16: 79,024,335	N506I	probably damaging	Het
Topors	A	T	4: 40,260,686	I866K	unknown	Het
Trip12	G	T	1: 84,766,050	T512K	possibly damaging	Het
Ubr1	T	A	2: 120,961,104	H133L	probably damaging	Het
Wwtr1	T	C	3: 57,459,020	D422G	probably damaging	Het
Zfp689	A	C	7: 127,444,586	C291G	probably damaging	Het
Zfyve9	A	G	4: 108,719,680	L68P	possibly damaging	Het
Zswim5	G	T	4: 116,878,022	R188L	probably benign	Het

Other mutations in Taf4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01658:Taf4b	APN	18	14844420	missense	probably damaging	1.00
IGL01755:Taf4b	APN	18	14897985	missense	probably benign
IGL01755:Taf4b	APN	18	14897986	missense	probably benign	0.13
IGL02049:Taf4b	APN	18	14830139	missense	probably benign	0.00
IGL02650:Taf4b	APN	18	14841983	nonsense	probably null
IGL03078:Taf4b	APN	18	14813554	missense	possibly damaging	0.48
IGL03169:Taf4b	APN	18	14821535	missense	probably damaging	1.00
IGL03261:Taf4b	APN	18	14821528	missense	probably benign
adirondack	UTSW	18	14804578	missense	probably null	0.16
R0266:Taf4b	UTSW	18	14813077	splice site	probably benign
R0385:Taf4b	UTSW	18	14783760	missense	probably benign	0.00
R1015:Taf4b	UTSW	18	14813098	missense	probably damaging	1.00
R1054:Taf4b	UTSW	18	14821473	missense	probably benign	0.00
R1416:Taf4b	UTSW	18	14821427	splice site	probably benign
R1435:Taf4b	UTSW	18	14807409	missense	probably damaging	1.00
R1609:Taf4b	UTSW	18	14835881	missense	probably damaging	1.00
R1611:Taf4b	UTSW	18	14844469	missense	probably null	1.00
R1906:Taf4b	UTSW	18	14822102	missense	probably benign	0.00
R2038:Taf4b	UTSW	18	14807399	missense	probably damaging	1.00
R2890:Taf4b	UTSW	18	14804792	missense	probably damaging	1.00
R4527:Taf4b	UTSW	18	14821442	missense	probably damaging	1.00
R4559:Taf4b	UTSW	18	14813526	missense	probably damaging	1.00
R4773:Taf4b	UTSW	18	14804520	missense	probably benign	0.30
R4857:Taf4b	UTSW	18	14804578	missense	probably null	0.16
R4946:Taf4b	UTSW	18	14813542	missense	probably damaging	1.00
R4984:Taf4b	UTSW	18	14835816	missense	probably damaging	1.00
R4994:Taf4b	UTSW	18	14898043	missense	probably damaging	0.99
R5010:Taf4b	UTSW	18	14822172	missense	possibly damaging	0.59
R5155:Taf4b	UTSW	18	14830095	missense	probably benign	0.07
R5874:Taf4b	UTSW	18	14804554	missense	probably benign
R6079:Taf4b	UTSW	18	14822198	missense	possibly damaging	0.75
R6303:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6304:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6372:Taf4b	UTSW	18	14804733	missense	probably damaging	1.00
R6972:Taf4b	UTSW	18	14813347	missense	possibly damaging	0.86
R7538:Taf4b	UTSW	18	14813545	missense	probably damaging	1.00
R7790:Taf4b	UTSW	18	14813274	missense	probably damaging	1.00
R8021:Taf4b	UTSW	18	14804524	missense	probably damaging	1.00
R8072:Taf4b	UTSW	18	14821528	missense	probably benign
R8075:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8145:Taf4b	UTSW	18	14830028	missense	probably damaging	1.00
R8320:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8509:Taf4b	UTSW	18	14898055	missense	probably damaging	1.00
R8535:Taf4b	UTSW	18	14822138	missense	probably damaging	0.99
R8772:Taf4b	UTSW	18	14835852	missense	probably damaging	1.00
R8805:Taf4b	UTSW	18	14813428	missense	possibly damaging	0.65
R8874:Taf4b	UTSW	18	14830070	missense	probably benign	0.39
R9155:Taf4b	UTSW	18	14813239	missense	probably benign	0.00
R9254:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98
R9338:Taf4b	UTSW	18	14821498	missense	probably benign	0.00
R9379:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATACCTTCCCAATGGACAGTGC -3'
(R):5'- AGACGTAGCAAAAGCTTGTCAG -3'

Sequencing Primer
(F):5'- CAATGGACAGTGCCACGTG -3'
(R):5'- CAGTGTAAGCAGTGGTCTTCCATAC -3'

Posted On

2020-07-13