Incidental Mutation 'R8222:Olfr1156'
ID636743
Institutional Source Beutler Lab
Gene Symbol Olfr1156
Ensembl Gene ENSMUSG00000075144
Gene Nameolfactory receptor 1156
SynonymsMOR174-3, GA_x6K02T2Q125-49433499-49432537
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R8222 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87947053-87953100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87949444 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 263 (N263S)
Ref Sequence ENSEMBL: ENSMUSP00000097430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099842]
Predicted Effect probably benign
Transcript: ENSMUST00000099842
AA Change: N263S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097430
Gene: ENSMUSG00000075144
AA Change: N263S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-47 PFAM
Pfam:7tm_1 41 290 1.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 C T 19: 40,573,852 V243I probably benign Het
Ankrd11 A T 8: 122,895,608 S481T probably damaging Het
Atg2b A G 12: 105,652,216 I859T possibly damaging Het
B4galt3 G A 1: 171,272,683 R141Q possibly damaging Het
Bace1 T C 9: 45,857,193 V262A probably damaging Het
BC106179 A T 16: 23,224,305 I47N noncoding transcript Het
Brpf1 C T 6: 113,310,038 P76S probably benign Het
Cdk1 A G 10: 69,340,596 V227A probably benign Het
Ceacam20 T C 7: 19,971,693 V203A probably benign Het
Cma2 T C 14: 55,973,270 V194A probably benign Het
Cnnm4 A G 1: 36,506,536 D749G probably benign Het
Cyp11b2 T C 15: 74,856,210 T8A probably benign Het
Dlk2 A G 17: 46,302,458 H170R probably benign Het
E330021D16Rik A G 6: 136,400,884 I316T probably damaging Het
Esyt1 C T 10: 128,511,778 R987Q possibly damaging Het
Ganc T C 2: 120,446,452 I665T probably damaging Het
Gas6 T C 8: 13,470,276 T471A probably benign Het
Gm13084 A T 4: 143,810,323 D479E possibly damaging Het
Grik2 A G 10: 49,573,648 F153L probably benign Het
Heatr5b A G 17: 78,801,701 V1043A possibly damaging Het
Ipo5 A G 14: 120,920,002 D84G probably benign Het
Irak4 T A 15: 94,561,229 probably null Het
Lrp4 T A 2: 91,474,741 C238S probably damaging Het
Mau2 A T 8: 70,033,177 probably null Het
Mdn1 T C 4: 32,707,477 F1589L probably benign Het
Mlxip T G 5: 123,447,533 S662A probably benign Het
Mn1 A T 5: 111,418,680 N172I probably damaging Het
Mup2 A C 4: 60,138,454 D79E probably benign Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Nlrp3 A G 11: 59,548,788 E397G probably damaging Het
Odf2l A G 3: 145,128,038 E153G probably damaging Het
Olfr1163 T A 2: 88,071,037 Y115F probably benign Het
Olfr561 G T 7: 102,774,892 D123Y probably damaging Het
Olfr62 T C 4: 118,665,916 L133P probably damaging Het
Pkdrej T A 15: 85,817,439 H1432L probably benign Het
Plec C T 15: 76,179,174 R2232H possibly damaging Het
Polk T C 13: 96,495,515 M317V possibly damaging Het
Prdm9 A G 17: 15,544,773 S582P possibly damaging Het
R3hcc1l T A 19: 42,576,177 L643H probably damaging Het
Rassf8 G A 6: 145,820,057 V38M unknown Het
Reln G A 5: 21,931,477 Q2518* probably null Het
Sel1l3 A G 5: 53,187,954 probably null Het
Serpina3m A T 12: 104,392,701 D324V possibly damaging Het
Slc12a6 T A 2: 112,339,525 probably null Het
Slc25a3 A G 10: 91,118,191 W219R probably damaging Het
Smek1 A G 12: 101,041,905 S758P probably benign Het
Sort1 T A 3: 108,334,635 V299E probably benign Het
Stx6 A G 1: 155,198,143 D233G possibly damaging Het
Tefm A G 11: 80,140,404 V2A Het
Tfdp2 T C 9: 96,310,613 S190P possibly damaging Het
Tmprss7 A T 16: 45,658,098 I755N probably damaging Het
Trpm8 A G 1: 88,325,668 probably null Het
Ugt2a2 A G 5: 87,460,510 L490P probably damaging Het
Utp20 A G 10: 88,778,372 L1240P probably damaging Het
Vmn1r159 G T 7: 22,843,183 Y141* probably null Het
Vmn2r56 T A 7: 12,711,033 Y431F probably benign Het
Wdr66 T A 5: 123,302,423 Y1091N probably damaging Het
Other mutations in Olfr1156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Olfr1156 APN 2 87949863 missense probably damaging 0.99
IGL02831:Olfr1156 APN 2 87949676 splice site probably null
IGL03214:Olfr1156 APN 2 87950071 missense probably benign 0.16
R0285:Olfr1156 UTSW 2 87950131 missense probably damaging 0.98
R0926:Olfr1156 UTSW 2 87949922 missense probably damaging 1.00
R0987:Olfr1156 UTSW 2 87949547 missense probably benign 0.12
R1422:Olfr1156 UTSW 2 87950095 missense probably benign 0.00
R1958:Olfr1156 UTSW 2 87949465 missense probably damaging 1.00
R2239:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R2380:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R3872:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3873:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3874:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R4526:Olfr1156 UTSW 2 87949409 missense probably benign 0.09
R5116:Olfr1156 UTSW 2 87949529 missense probably benign 0.03
R5985:Olfr1156 UTSW 2 87949321 missense probably benign 0.02
R5999:Olfr1156 UTSW 2 87949801 splice site probably null
R6127:Olfr1156 UTSW 2 87949361 missense probably damaging 1.00
R6259:Olfr1156 UTSW 2 87949435 missense probably benign 0.20
R6544:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6556:Olfr1156 UTSW 2 87949976 missense probably benign 0.00
R6715:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6951:Olfr1156 UTSW 2 87949979 missense possibly damaging 0.79
R7062:Olfr1156 UTSW 2 87950224 missense probably benign 0.01
R7142:Olfr1156 UTSW 2 87949712 missense probably benign 0.09
R7749:Olfr1156 UTSW 2 87949478 missense probably damaging 1.00
R7887:Olfr1156 UTSW 2 87949880 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTTCACTATGAAACCCTAAG -3'
(R):5'- TAATTCACCTGTGCTTGGCC -3'

Sequencing Primer
(F):5'- AGAGCCTCTTTCACATCCT -3'
(R):5'- GTGCTTGGCCCTTGAGATCAC -3'
Posted On2020-07-13