Incidental Mutation 'R0718:Scn9a'
ID63675
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Namesodium channel, voltage-gated, type IX, alpha
SynonymsPN1
MMRRC Submission 038900-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0718 (G1)
Quality Score99
Status Validated
Chromosome2
Chromosomal Location66480080-66634962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66547112 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 409 (N409D)
Ref Sequence ENSEMBL: ENSMUSP00000126528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
Predicted Effect probably damaging
Transcript: ENSMUST00000100063
AA Change: N411D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: N411D

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100064
AA Change: N409D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: N409D

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112354
AA Change: N409D

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: N409D

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151234
Predicted Effect probably damaging
Transcript: ENSMUST00000164384
AA Change: N409D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: N409D

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169900
AA Change: N409D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: N409D

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Meta Mutation Damage Score 0.2417 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,679,608 Y811N possibly damaging Het
Adrm1 T C 2: 180,175,147 probably benign Het
Alms1 T A 6: 85,621,821 S1210T probably benign Het
Ampd3 C T 7: 110,777,808 P11L probably damaging Het
Arhgap5 A G 12: 52,516,507 E87G possibly damaging Het
Armc5 C T 7: 128,240,070 probably benign Het
Asic2 C G 11: 80,971,456 probably benign Het
Asph A G 4: 9,514,683 probably benign Het
Bicd2 T A 13: 49,377,875 probably null Het
Brip1 A G 11: 86,143,305 L530P possibly damaging Het
Bsn G T 9: 108,111,360 probably benign Het
Btnl4 T A 17: 34,469,634 H390L probably benign Het
Ccdc70 A C 8: 21,973,308 K38T probably damaging Het
Ccni G A 5: 93,202,316 P35S probably benign Het
Cdh17 A G 4: 11,810,451 D714G possibly damaging Het
Cenpf A G 1: 189,653,984 L2033P probably damaging Het
Cfap69 A T 5: 5,621,924 M328K probably damaging Het
Cmah T G 13: 24,417,210 probably null Het
Cog6 T C 3: 53,010,629 T163A probably benign Het
Cyp2j8 G A 4: 96,501,196 S130F probably benign Het
Dgki A G 6: 37,012,896 V636A probably damaging Het
Dmkn T A 7: 30,764,786 probably benign Het
Dnah6 A G 6: 73,035,293 I3679T possibly damaging Het
Dsp A T 13: 38,196,764 Y2495F possibly damaging Het
Exosc4 C T 15: 76,329,489 A171V probably benign Het
Fbxw24 A G 9: 109,623,509 probably benign Het
Flvcr1 A T 1: 191,025,582 L171Q probably damaging Het
Fsd1 G T 17: 55,996,445 probably null Het
Gm7732 A G 17: 21,129,844 noncoding transcript Het
H2-K2 A C 17: 33,975,623 noncoding transcript Het
Hgf A G 5: 16,593,859 N295S probably damaging Het
Ift88 T A 14: 57,517,413 D811E probably benign Het
Igsf9b T A 9: 27,323,361 probably null Het
Immt T A 6: 71,863,172 V311E probably damaging Het
Ipo11 T A 13: 106,919,611 N51I possibly damaging Het
Isy1 T C 6: 87,819,176 K260E probably damaging Het
Jchain T G 5: 88,526,202 I28L probably benign Het
Jmjd1c T A 10: 67,218,946 probably null Het
Kif13b T C 14: 64,751,662 probably benign Het
Klhdc7b T C 15: 89,388,169 Y427H possibly damaging Het
Klhl8 T C 5: 103,876,293 probably benign Het
Lrp2 C T 2: 69,510,948 D963N probably damaging Het
Ltbp3 G T 19: 5,746,748 probably benign Het
Ltf C A 9: 111,040,379 Q41K probably benign Het
Med4 T A 14: 73,516,657 I148N probably damaging Het
Mlh3 T G 12: 85,247,697 S1242R possibly damaging Het
Mllt6 T C 11: 97,676,359 probably benign Het
Mpdz A G 4: 81,292,473 I1712T possibly damaging Het
Mrgprb4 T A 7: 48,198,553 H209L probably benign Het
Nkapl A T 13: 21,468,440 M1K probably null Het
Nmur2 T A 11: 56,029,498 probably benign Het
Nsun2 T A 13: 69,543,697 probably benign Het
Olfr1082 G A 2: 86,594,081 T249I probably benign Het
Olfr1130 A G 2: 87,607,927 I180V probably benign Het
Ovgp1 T C 3: 105,974,830 probably benign Het
Pcdh8 A G 14: 79,770,691 V144A possibly damaging Het
Pcnx3 G A 19: 5,677,728 probably benign Het
Pla2r1 C A 2: 60,479,530 V570L possibly damaging Het
Plxnd1 C A 6: 115,966,638 E1202D possibly damaging Het
Ppp1r37 T C 7: 19,532,254 E529G probably benign Het
Prdm15 A G 16: 97,812,633 F496L possibly damaging Het
Prlhr A T 19: 60,468,005 V41D probably benign Het
Prlhr G T 19: 60,468,059 S23* probably null Het
Prpf4 C T 4: 62,414,540 probably benign Het
Psg26 C T 7: 18,475,235 R416H probably benign Het
Psg26 T C 7: 18,478,287 H381R probably benign Het
Ralgds T G 2: 28,549,116 M717R probably benign Het
Rbms1 T C 2: 60,842,412 N44D probably damaging Het
Rpa1 T C 11: 75,318,401 probably benign Het
Rprd2 T C 3: 95,766,387 N568S probably benign Het
Rptor A G 11: 119,872,376 M929V probably benign Het
Rspo1 T A 4: 125,007,149 C97S possibly damaging Het
Scin C T 12: 40,079,607 G396S probably damaging Het
Sf3b1 A G 1: 55,019,385 I15T probably damaging Het
Sh3bp2 T C 5: 34,555,495 V149A probably damaging Het
Slc39a12 T A 2: 14,407,426 probably benign Het
Sp9 G T 2: 73,273,827 A242S possibly damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tatdn3 G T 1: 191,052,849 probably benign Het
Tex14 G A 11: 87,499,613 V379I probably benign Het
Tmed6 T C 8: 107,061,724 N197S probably damaging Het
Ttbk2 A T 2: 120,745,160 I1043N probably benign Het
Ttbk2 G A 2: 120,748,575 L689F probably benign Het
Ttn A G 2: 76,810,696 S5283P probably damaging Het
Ube3b C A 5: 114,402,555 S441* probably null Het
Ush2a G A 1: 188,797,830 C3272Y probably damaging Het
Vac14 T A 8: 110,632,477 I95K probably damaging Het
Vangl2 G A 1: 172,006,217 A433V probably damaging Het
Vwa5b1 A T 4: 138,608,824 V153D probably damaging Het
Zfhx3 T A 8: 108,955,650 D3240E unknown Het
Zfp945 A G 17: 22,851,030 C632R probably damaging Het
Zfyve26 G A 12: 79,265,802 probably benign Het
Zyg11b A T 4: 108,242,076 I606N possibly damaging Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66563601 missense probably damaging 1.00
IGL00570:Scn9a APN 2 66484142 missense probably damaging 1.00
IGL00809:Scn9a APN 2 66483935 missense probably damaging 1.00
IGL00977:Scn9a APN 2 66484301 missense probably damaging 0.99
IGL01120:Scn9a APN 2 66526972 missense probably benign 0.00
IGL01134:Scn9a APN 2 66504968 missense probably damaging 1.00
IGL01300:Scn9a APN 2 66488053 nonsense probably null
IGL01452:Scn9a APN 2 66527072 missense probably damaging 1.00
IGL01531:Scn9a APN 2 66537378 missense probably benign 0.11
IGL01572:Scn9a APN 2 66493886 missense probably benign 0.00
IGL01645:Scn9a APN 2 66487642 missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66484042 missense probably damaging 1.00
IGL01965:Scn9a APN 2 66484433 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66547135 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66494826 missense probably damaging 1.00
IGL02166:Scn9a APN 2 66493103 missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66484611 splice site probably benign
IGL02640:Scn9a APN 2 66536096 critical splice donor site probably null
IGL02685:Scn9a APN 2 66537293 missense probably damaging 1.00
IGL02798:Scn9a APN 2 66540559 missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66568029 missense probably damaging 1.00
IGL03008:Scn9a APN 2 66562511 missense probably damaging 1.00
IGL03270:Scn9a APN 2 66484014 missense probably damaging 1.00
IGL03408:Scn9a APN 2 66526747 missense probably benign 0.00
BB007:Scn9a UTSW 2 66504849 missense probably damaging 0.99
BB017:Scn9a UTSW 2 66504849 missense probably damaging 0.99
R0039:Scn9a UTSW 2 66562444 missense probably damaging 0.98
R0173:Scn9a UTSW 2 66533093 missense probably damaging 1.00
R0323:Scn9a UTSW 2 66568131 missense probably damaging 1.00
R0344:Scn9a UTSW 2 66505010 missense probably damaging 0.99
R0421:Scn9a UTSW 2 66543277 missense probably benign
R0465:Scn9a UTSW 2 66526996 missense probably damaging 1.00
R0514:Scn9a UTSW 2 66483678 missense probably damaging 1.00
R0599:Scn9a UTSW 2 66526799 missense probably damaging 0.96
R0627:Scn9a UTSW 2 66537377 missense probably benign 0.00
R0644:Scn9a UTSW 2 66533061 critical splice donor site probably null
R0653:Scn9a UTSW 2 66533377 missense probably damaging 1.00
R0685:Scn9a UTSW 2 66483499 missense probably benign 0.02
R0827:Scn9a UTSW 2 66536124 nonsense probably null
R0890:Scn9a UTSW 2 66483735 missense probably damaging 1.00
R1139:Scn9a UTSW 2 66504997 missense probably benign 0.02
R1385:Scn9a UTSW 2 66563542 missense probably damaging 1.00
R1398:Scn9a UTSW 2 66484586 missense probably benign 0.11
R1496:Scn9a UTSW 2 66526888 missense probably benign
R1511:Scn9a UTSW 2 66526813 missense probably benign 0.01
R1517:Scn9a UTSW 2 66505027 splice site probably benign
R1564:Scn9a UTSW 2 66484304 missense probably damaging 1.00
R1634:Scn9a UTSW 2 66488017 missense probably damaging 1.00
R1662:Scn9a UTSW 2 66483459 missense probably benign 0.00
R1695:Scn9a UTSW 2 66504876 nonsense probably null
R1709:Scn9a UTSW 2 66483506 missense probably damaging 1.00
R1741:Scn9a UTSW 2 66487594 missense probably damaging 0.99
R1755:Scn9a UTSW 2 66501716 missense probably benign 0.38
R1914:Scn9a UTSW 2 66566250 missense probably damaging 1.00
R1962:Scn9a UTSW 2 66484311 missense probably damaging 1.00
R1970:Scn9a UTSW 2 66515380 missense probably damaging 0.97
R2017:Scn9a UTSW 2 66515321 missense probably damaging 0.99
R2092:Scn9a UTSW 2 66533376 missense probably damaging 0.99
R2105:Scn9a UTSW 2 66568183 missense probably benign 0.25
R2114:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2115:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2128:Scn9a UTSW 2 66526654 missense probably damaging 1.00
R2157:Scn9a UTSW 2 66536325 missense probably damaging 1.00
R2162:Scn9a UTSW 2 66534229 missense probably damaging 0.98
R2350:Scn9a UTSW 2 66504968 missense probably damaging 1.00
R3694:Scn9a UTSW 2 66562405 missense probably benign
R3771:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3772:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3773:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3922:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66565054 intron probably benign
R4385:Scn9a UTSW 2 66484556 missense probably damaging 1.00
R4415:Scn9a UTSW 2 66526693 missense probably damaging 1.00
R4570:Scn9a UTSW 2 66483558 missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66547018 missense probably benign
R4783:Scn9a UTSW 2 66540623 missense probably benign 0.01
R4822:Scn9a UTSW 2 66483749 missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66551713 missense probably benign
R4908:Scn9a UTSW 2 66526743 missense probably benign 0.03
R4983:Scn9a UTSW 2 66566270 missense probably benign 0.02
R5047:Scn9a UTSW 2 66562480 missense probably damaging 1.00
R5100:Scn9a UTSW 2 66534119 missense probably damaging 1.00
R5140:Scn9a UTSW 2 66565167 missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66488043 missense probably damaging 1.00
R5557:Scn9a UTSW 2 66547103 missense probably damaging 0.99
R5582:Scn9a UTSW 2 66565029 intron probably benign
R6108:Scn9a UTSW 2 66484049 missense probably damaging 1.00
R6115:Scn9a UTSW 2 66563629 missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66487524 missense probably benign 0.00
R6261:Scn9a UTSW 2 66483896 missense probably damaging 1.00
R6335:Scn9a UTSW 2 66568264 start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66526963 missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66483502 missense probably benign 0.23
R6681:Scn9a UTSW 2 66563342 missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66568029 missense probably damaging 1.00
R7102:Scn9a UTSW 2 66549015 missense probably damaging 1.00
R7186:Scn9a UTSW 2 66534223 missense probably damaging 1.00
R7243:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R7311:Scn9a UTSW 2 66484404 missense possibly damaging 0.54
R7328:Scn9a UTSW 2 66484587 missense probably benign
R7386:Scn9a UTSW 2 66540550 missense probably damaging 1.00
R7438:Scn9a UTSW 2 66547187 missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66533348 missense probably damaging 0.99
R7485:Scn9a UTSW 2 66534217 missense probably damaging 1.00
R7526:Scn9a UTSW 2 66483646 missense probably benign
R7617:Scn9a UTSW 2 66540549 missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66536236 missense probably benign 0.02
R7653:Scn9a UTSW 2 66527080 missense probably damaging 1.00
R7747:Scn9a UTSW 2 66484298 missense probably damaging 1.00
R7823:Scn9a UTSW 2 66483791 missense probably damaging 1.00
R7864:Scn9a UTSW 2 66484560 missense possibly damaging 0.73
R7890:Scn9a UTSW 2 66543112 missense probably benign 0.00
R7930:Scn9a UTSW 2 66504849 missense probably damaging 0.99
R7975:Scn9a UTSW 2 66484253 missense probably damaging 1.00
R8057:Scn9a UTSW 2 66515430 missense probably benign 0.06
R8145:Scn9a UTSW 2 66487410 missense probably damaging 1.00
R8163:Scn9a UTSW 2 66484401 missense probably damaging 1.00
R8165:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R8342:Scn9a UTSW 2 66536282 missense probably benign
R8345:Scn9a UTSW 2 66494622 missense probably damaging 0.96
R8464:Scn9a UTSW 2 66566281 missense probably damaging 0.99
R8467:Scn9a UTSW 2 66501671 missense probably damaging 1.00
R8698:Scn9a UTSW 2 66536284 missense probably benign 0.00
R8810:Scn9a UTSW 2 66501666 missense probably damaging 1.00
R8822:Scn9a UTSW 2 66540635 missense probably damaging 0.99
R8829:Scn9a UTSW 2 66483617 missense probably benign
X0003:Scn9a UTSW 2 66508647 missense probably benign 0.02
X0062:Scn9a UTSW 2 66568077 missense probably damaging 1.00
Z1176:Scn9a UTSW 2 66540592 missense probably benign 0.00
Z1177:Scn9a UTSW 2 66494685 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GTGGAAAGACCTTTGTCCCACCTG -3'
(R):5'- TGCTGCATGGCAAGATACACTGC -3'

Sequencing Primer
(F):5'- ACCTGCTTTGCCTTCGTG -3'
(R):5'- GGGCCTGTTTCAAAAAGTTAAAAGAC -3'
Posted On2013-07-30