Mutagenetix > Incidental Mutations

Incidental Mutation 'R8222:Rassf8'

636761

Institutional Source

Beutler Lab

Gene Symbol

Rassf8

Ensembl Gene

ENSMUSG00000030259

Gene Name

Ras association (RalGDS/AF-6) domain family (N-terminal) member 8

Synonyms

5133400D11Rik, mHoj-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.774) question?

Stock #

R8222 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145746748-145821079 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 145820057 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 38 (V38M)

Ref Sequence

ENSEMBL: ENSMUSP00000130671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]

Predicted Effect

probably benign
Transcript: ENSMUST00000032388

SMART Domains

Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000058538
AA Change: V38M

Predicted Effect

probably benign
Transcript: ENSMUST00000111704

SMART Domains

Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140966

SMART Domains

Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	80	7.85e-7	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh18a1	C	T	19: 40,573,852	V243I	probably benign	Het
Ankrd11	A	T	8: 122,895,608	S481T	probably damaging	Het
Atg2b	A	G	12: 105,652,216	I859T	possibly damaging	Het
B4galt3	G	A	1: 171,272,683	R141Q	possibly damaging	Het
Bace1	T	C	9: 45,857,193	V262A	probably damaging	Het
BC106179	A	T	16: 23,224,305	I47N	noncoding transcript	Het
Brpf1	C	T	6: 113,310,038	P76S	probably benign	Het
Cdk1	A	G	10: 69,340,596	V227A	probably benign	Het
Ceacam20	T	C	7: 19,971,693	V203A	probably benign	Het
Cma2	T	C	14: 55,973,270	V194A	probably benign	Het
Cnnm4	A	G	1: 36,506,536	D749G	probably benign	Het
Cyp11b2	T	C	15: 74,856,210	T8A	probably benign	Het
Dlk2	A	G	17: 46,302,458	H170R	probably benign	Het
E330021D16Rik	A	G	6: 136,400,884	I316T	probably damaging	Het
Esyt1	C	T	10: 128,511,778	R987Q	possibly damaging	Het
Ganc	T	C	2: 120,446,452	I665T	probably damaging	Het
Gas6	T	C	8: 13,470,276	T471A	probably benign	Het
Gm13084	A	T	4: 143,810,323	D479E	possibly damaging	Het
Grik2	A	G	10: 49,573,648	F153L	probably benign	Het
Heatr5b	A	G	17: 78,801,701	V1043A	possibly damaging	Het
Ipo5	A	G	14: 120,920,002	D84G	probably benign	Het
Irak4	T	A	15: 94,561,229		probably null	Het
Lrp4	T	A	2: 91,474,741	C238S	probably damaging	Het
Mau2	A	T	8: 70,033,177		probably null	Het
Mdn1	T	C	4: 32,707,477	F1589L	probably benign	Het
Mlxip	T	G	5: 123,447,533	S662A	probably benign	Het
Mn1	A	T	5: 111,418,680	N172I	probably damaging	Het
Mup2	A	C	4: 60,138,454	D79E	probably benign	Het
Nab2	C	A	10: 127,662,776	V475L	probably benign	Het
Nlrp3	A	G	11: 59,548,788	E397G	probably damaging	Het
Odf2l	A	G	3: 145,128,038	E153G	probably damaging	Het
Olfr1156	T	C	2: 87,949,444	N263S	probably benign	Het
Olfr1163	T	A	2: 88,071,037	Y115F	probably benign	Het
Olfr561	G	T	7: 102,774,892	D123Y	probably damaging	Het
Olfr62	T	C	4: 118,665,916	L133P	probably damaging	Het
Pkdrej	T	A	15: 85,817,439	H1432L	probably benign	Het
Plec	C	T	15: 76,179,174	R2232H	possibly damaging	Het
Polk	T	C	13: 96,495,515	M317V	possibly damaging	Het
Prdm9	A	G	17: 15,544,773	S582P	possibly damaging	Het
R3hcc1l	T	A	19: 42,576,177	L643H	probably damaging	Het
Reln	G	A	5: 21,931,477	Q2518*	probably null	Het
Sel1l3	A	G	5: 53,187,954		probably null	Het
Serpina3m	A	T	12: 104,392,701	D324V	possibly damaging	Het
Slc12a6	T	A	2: 112,339,525		probably null	Het
Slc25a3	A	G	10: 91,118,191	W219R	probably damaging	Het
Smek1	A	G	12: 101,041,905	S758P	probably benign	Het
Sort1	T	A	3: 108,334,635	V299E	probably benign	Het
Stx6	A	G	1: 155,198,143	D233G	possibly damaging	Het
Tefm	A	G	11: 80,140,404	V2A		Het
Tfdp2	T	C	9: 96,310,613	S190P	possibly damaging	Het
Tmprss7	A	T	16: 45,658,098	I755N	probably damaging	Het
Trpm8	A	G	1: 88,325,668		probably null	Het
Ugt2a2	A	G	5: 87,460,510	L490P	probably damaging	Het
Utp20	A	G	10: 88,778,372	L1240P	probably damaging	Het
Vmn1r159	G	T	7: 22,843,183	Y141*	probably null	Het
Vmn2r56	T	A	7: 12,711,033	Y431F	probably benign	Het
Wdr66	T	A	5: 123,302,423	Y1091N	probably damaging	Het

Other mutations in Rassf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02973:Rassf8	APN	6	145817190	unclassified	probably benign
IGL03017:Rassf8	APN	6	145817198	splice site	probably null
IGL03091:Rassf8	APN	6	145815810	missense	probably benign	0.00
R0230:Rassf8	UTSW	6	145819974	unclassified	probably benign
R0967:Rassf8	UTSW	6	145819950	unclassified	probably benign
R1429:Rassf8	UTSW	6	145815190	missense	probably damaging	1.00
R1622:Rassf8	UTSW	6	145820103	unclassified	probably benign
R1738:Rassf8	UTSW	6	145815308	missense	probably benign	0.03
R1894:Rassf8	UTSW	6	145808473	missense	probably damaging	1.00
R2126:Rassf8	UTSW	6	145815182	missense	probably benign	0.00
R2238:Rassf8	UTSW	6	145817184	missense	probably damaging	1.00
R2439:Rassf8	UTSW	6	145815334	missense	probably damaging	1.00
R3699:Rassf8	UTSW	6	145820076	unclassified	probably benign
R4678:Rassf8	UTSW	6	145815082	missense	probably damaging	1.00
R4734:Rassf8	UTSW	6	145815540	missense	probably benign	0.34
R4826:Rassf8	UTSW	6	145816550	missense	probably damaging	1.00
R4910:Rassf8	UTSW	6	145815280	nonsense	probably null
R4988:Rassf8	UTSW	6	145817144	missense	possibly damaging	0.89
R5425:Rassf8	UTSW	6	145815542	missense	probably benign
R5620:Rassf8	UTSW	6	145820181	unclassified	probably benign
R5747:Rassf8	UTSW	6	145815815	missense	probably benign	0.00
R6136:Rassf8	UTSW	6	145815656	missense	probably benign	0.00
R6220:Rassf8	UTSW	6	145817133	missense	probably damaging	1.00
R7274:Rassf8	UTSW	6	145815569	missense	probably benign	0.03
R7315:Rassf8	UTSW	6	145815751	missense	probably benign
R7480:Rassf8	UTSW	6	145820031	missense	unknown
R7593:Rassf8	UTSW	6	145815403	missense	probably benign	0.08
R7714:Rassf8	UTSW	6	145815247	missense	probably damaging	0.98
R7962:Rassf8	UTSW	6	145815943	critical splice donor site	probably null
R8374:Rassf8	UTSW	6	145815137	nonsense	probably null
R8409:Rassf8	UTSW	6	145815703	missense	probably benign
Z1088:Rassf8	UTSW	6	145815482	missense	probably benign
Z1088:Rassf8	UTSW	6	145816616	missense	probably benign	0.41
Z1176:Rassf8	UTSW	6	145816642	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGTGGGTTACCTCACTTTGTG -3'
(R):5'- CAATCTATCAAGGTCCTTACTTGC -3'

Sequencing Primer
(F):5'- TCTCCGTGAACAGGGAAT -3'
(R):5'- GCAAAGATGTTCCCAGATGTTGCTC -3'

Posted On

2020-07-13