Incidental Mutation 'R8222:Rassf8'
ID636761
Institutional Source Beutler Lab
Gene Symbol Rassf8
Ensembl Gene ENSMUSG00000030259
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 8
Synonyms5133400D11Rik, mHoj-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R8222 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location145746748-145821079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 145820057 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 38 (V38M)
Ref Sequence ENSEMBL: ENSMUSP00000130671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]
Predicted Effect probably benign
Transcript: ENSMUST00000032388
SMART Domains Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000058538
AA Change: V38M
Predicted Effect probably benign
Transcript: ENSMUST00000111704
SMART Domains Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140966
SMART Domains Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 80 7.85e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 C T 19: 40,573,852 V243I probably benign Het
Ankrd11 A T 8: 122,895,608 S481T probably damaging Het
Atg2b A G 12: 105,652,216 I859T possibly damaging Het
B4galt3 G A 1: 171,272,683 R141Q possibly damaging Het
Bace1 T C 9: 45,857,193 V262A probably damaging Het
BC106179 A T 16: 23,224,305 I47N noncoding transcript Het
Brpf1 C T 6: 113,310,038 P76S probably benign Het
Cdk1 A G 10: 69,340,596 V227A probably benign Het
Ceacam20 T C 7: 19,971,693 V203A probably benign Het
Cma2 T C 14: 55,973,270 V194A probably benign Het
Cnnm4 A G 1: 36,506,536 D749G probably benign Het
Cyp11b2 T C 15: 74,856,210 T8A probably benign Het
Dlk2 A G 17: 46,302,458 H170R probably benign Het
E330021D16Rik A G 6: 136,400,884 I316T probably damaging Het
Esyt1 C T 10: 128,511,778 R987Q possibly damaging Het
Ganc T C 2: 120,446,452 I665T probably damaging Het
Gas6 T C 8: 13,470,276 T471A probably benign Het
Gm13084 A T 4: 143,810,323 D479E possibly damaging Het
Grik2 A G 10: 49,573,648 F153L probably benign Het
Heatr5b A G 17: 78,801,701 V1043A possibly damaging Het
Ipo5 A G 14: 120,920,002 D84G probably benign Het
Irak4 T A 15: 94,561,229 probably null Het
Lrp4 T A 2: 91,474,741 C238S probably damaging Het
Mau2 A T 8: 70,033,177 probably null Het
Mdn1 T C 4: 32,707,477 F1589L probably benign Het
Mlxip T G 5: 123,447,533 S662A probably benign Het
Mn1 A T 5: 111,418,680 N172I probably damaging Het
Mup2 A C 4: 60,138,454 D79E probably benign Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Nlrp3 A G 11: 59,548,788 E397G probably damaging Het
Odf2l A G 3: 145,128,038 E153G probably damaging Het
Olfr1156 T C 2: 87,949,444 N263S probably benign Het
Olfr1163 T A 2: 88,071,037 Y115F probably benign Het
Olfr561 G T 7: 102,774,892 D123Y probably damaging Het
Olfr62 T C 4: 118,665,916 L133P probably damaging Het
Pkdrej T A 15: 85,817,439 H1432L probably benign Het
Plec C T 15: 76,179,174 R2232H possibly damaging Het
Polk T C 13: 96,495,515 M317V possibly damaging Het
Prdm9 A G 17: 15,544,773 S582P possibly damaging Het
R3hcc1l T A 19: 42,576,177 L643H probably damaging Het
Reln G A 5: 21,931,477 Q2518* probably null Het
Sel1l3 A G 5: 53,187,954 probably null Het
Serpina3m A T 12: 104,392,701 D324V possibly damaging Het
Slc12a6 T A 2: 112,339,525 probably null Het
Slc25a3 A G 10: 91,118,191 W219R probably damaging Het
Smek1 A G 12: 101,041,905 S758P probably benign Het
Sort1 T A 3: 108,334,635 V299E probably benign Het
Stx6 A G 1: 155,198,143 D233G possibly damaging Het
Tefm A G 11: 80,140,404 V2A Het
Tfdp2 T C 9: 96,310,613 S190P possibly damaging Het
Tmprss7 A T 16: 45,658,098 I755N probably damaging Het
Trpm8 A G 1: 88,325,668 probably null Het
Ugt2a2 A G 5: 87,460,510 L490P probably damaging Het
Utp20 A G 10: 88,778,372 L1240P probably damaging Het
Vmn1r159 G T 7: 22,843,183 Y141* probably null Het
Vmn2r56 T A 7: 12,711,033 Y431F probably benign Het
Wdr66 T A 5: 123,302,423 Y1091N probably damaging Het
Other mutations in Rassf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02973:Rassf8 APN 6 145817190 unclassified probably benign
IGL03017:Rassf8 APN 6 145817198 splice site probably null
IGL03091:Rassf8 APN 6 145815810 missense probably benign 0.00
R0230:Rassf8 UTSW 6 145819974 unclassified probably benign
R0967:Rassf8 UTSW 6 145819950 unclassified probably benign
R1429:Rassf8 UTSW 6 145815190 missense probably damaging 1.00
R1622:Rassf8 UTSW 6 145820103 unclassified probably benign
R1738:Rassf8 UTSW 6 145815308 missense probably benign 0.03
R1894:Rassf8 UTSW 6 145808473 missense probably damaging 1.00
R2126:Rassf8 UTSW 6 145815182 missense probably benign 0.00
R2238:Rassf8 UTSW 6 145817184 missense probably damaging 1.00
R2439:Rassf8 UTSW 6 145815334 missense probably damaging 1.00
R3699:Rassf8 UTSW 6 145820076 unclassified probably benign
R4678:Rassf8 UTSW 6 145815082 missense probably damaging 1.00
R4734:Rassf8 UTSW 6 145815540 missense probably benign 0.34
R4826:Rassf8 UTSW 6 145816550 missense probably damaging 1.00
R4910:Rassf8 UTSW 6 145815280 nonsense probably null
R4988:Rassf8 UTSW 6 145817144 missense possibly damaging 0.89
R5425:Rassf8 UTSW 6 145815542 missense probably benign
R5620:Rassf8 UTSW 6 145820181 unclassified probably benign
R5747:Rassf8 UTSW 6 145815815 missense probably benign 0.00
R6136:Rassf8 UTSW 6 145815656 missense probably benign 0.00
R6220:Rassf8 UTSW 6 145817133 missense probably damaging 1.00
R7274:Rassf8 UTSW 6 145815569 missense probably benign 0.03
R7315:Rassf8 UTSW 6 145815751 missense probably benign
R7480:Rassf8 UTSW 6 145820031 missense unknown
R7593:Rassf8 UTSW 6 145815403 missense probably benign 0.08
R7714:Rassf8 UTSW 6 145815247 missense probably damaging 0.98
R7962:Rassf8 UTSW 6 145815943 critical splice donor site probably null
R8374:Rassf8 UTSW 6 145815137 nonsense probably null
R8409:Rassf8 UTSW 6 145815703 missense probably benign
Z1088:Rassf8 UTSW 6 145815482 missense probably benign
Z1088:Rassf8 UTSW 6 145816616 missense probably benign 0.41
Z1176:Rassf8 UTSW 6 145816642 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTGGGTTACCTCACTTTGTG -3'
(R):5'- CAATCTATCAAGGTCCTTACTTGC -3'

Sequencing Primer
(F):5'- TCTCCGTGAACAGGGAAT -3'
(R):5'- GCAAAGATGTTCCCAGATGTTGCTC -3'
Posted On2020-07-13