Incidental Mutation 'R8222:Nlrp3'
ID 636777
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Cias1, cryopyrin, Pypaf1, NALP3, Mmig1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R8222 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 59541568-59566956 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59548788 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 397 (E397G)
Ref Sequence ENSEMBL: ENSMUSP00000078440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
AlphaFold Q8R4B8
Predicted Effect probably damaging
Transcript: ENSMUST00000079476
AA Change: E397G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: E397G

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101148
AA Change: E397G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: E397G

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (56/56)
MGI Phenotype Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 C T 19: 40,573,852 V243I probably benign Het
Ankrd11 A T 8: 122,895,608 S481T probably damaging Het
Atg2b A G 12: 105,652,216 I859T possibly damaging Het
B4galt3 G A 1: 171,272,683 R141Q possibly damaging Het
Bace1 T C 9: 45,857,193 V262A probably damaging Het
BC106179 A T 16: 23,224,305 I47N noncoding transcript Het
Brpf1 C T 6: 113,310,038 P76S probably benign Het
Cdk1 A G 10: 69,340,596 V227A probably benign Het
Ceacam20 T C 7: 19,971,693 V203A probably benign Het
Cma2 T C 14: 55,973,270 V194A probably benign Het
Cnnm4 A G 1: 36,506,536 D749G probably benign Het
Cyp11b2 T C 15: 74,856,210 T8A probably benign Het
Dlk2 A G 17: 46,302,458 H170R probably benign Het
E330021D16Rik A G 6: 136,400,884 I316T probably damaging Het
Esyt1 C T 10: 128,511,778 R987Q possibly damaging Het
Ganc T C 2: 120,446,452 I665T probably damaging Het
Gas6 T C 8: 13,470,276 T471A probably benign Het
Gm13084 A T 4: 143,810,323 D479E possibly damaging Het
Grik2 A G 10: 49,573,648 F153L probably benign Het
Heatr5b A G 17: 78,801,701 V1043A possibly damaging Het
Ipo5 A G 14: 120,920,002 D84G probably benign Het
Irak4 T A 15: 94,561,229 probably null Het
Lrp4 T A 2: 91,474,741 C238S probably damaging Het
Mau2 A T 8: 70,033,177 probably null Het
Mdn1 T C 4: 32,707,477 F1589L probably benign Het
Mlxip T G 5: 123,447,533 S662A probably benign Het
Mn1 A T 5: 111,418,680 N172I probably damaging Het
Mup2 A C 4: 60,138,454 D79E probably benign Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Odf2l A G 3: 145,128,038 E153G probably damaging Het
Olfr1156 T C 2: 87,949,444 N263S probably benign Het
Olfr1163 T A 2: 88,071,037 Y115F probably benign Het
Olfr561 G T 7: 102,774,892 D123Y probably damaging Het
Olfr62 T C 4: 118,665,916 L133P probably damaging Het
Pkdrej T A 15: 85,817,439 H1432L probably benign Het
Plec C T 15: 76,179,174 R2232H possibly damaging Het
Polk T C 13: 96,495,515 M317V possibly damaging Het
Prdm9 A G 17: 15,544,773 S582P possibly damaging Het
R3hcc1l T A 19: 42,576,177 L643H probably damaging Het
Rassf8 G A 6: 145,820,057 V38M unknown Het
Reln G A 5: 21,931,477 Q2518* probably null Het
Sel1l3 A G 5: 53,187,954 probably null Het
Serpina3m A T 12: 104,392,701 D324V possibly damaging Het
Slc12a6 T A 2: 112,339,525 probably null Het
Slc25a3 A G 10: 91,118,191 W219R probably damaging Het
Smek1 A G 12: 101,041,905 S758P probably benign Het
Sort1 T A 3: 108,334,635 V299E probably benign Het
Stx6 A G 1: 155,198,143 D233G possibly damaging Het
Tefm A G 11: 80,140,404 V2A Het
Tfdp2 T C 9: 96,310,613 S190P possibly damaging Het
Tmprss7 A T 16: 45,658,098 I755N probably damaging Het
Trpm8 A G 1: 88,325,668 probably null Het
Ugt2a2 A G 5: 87,460,510 L490P probably damaging Het
Utp20 A G 10: 88,778,372 L1240P probably damaging Het
Vmn1r159 G T 7: 22,843,183 Y141* probably null Het
Vmn2r56 T A 7: 12,711,033 Y431F probably benign Het
Wdr66 T A 5: 123,302,423 Y1091N probably damaging Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59565943 missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59565116 missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59551887 missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59549378 missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59549535 missense probably benign
IGL02334:Nlrp3 APN 11 59565083 missense probably benign
IGL02417:Nlrp3 APN 11 59566023 unclassified probably benign
IGL02578:Nlrp3 APN 11 59548401 missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59565976 missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59555782 missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59549546 missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59549016 missense probably damaging 1.00
Flogiston UTSW 11 59558448 missense probably benign 0.00
nd1 UTSW 11 59565974 missense probably benign 0.45
Nd14 UTSW 11 59555875 missense possibly damaging 0.89
Nd3 UTSW 11 59565974 missense probably benign 0.45
nd5 UTSW 11 59565879 missense probably benign 0.01
nd6 UTSW 11 59549354 missense probably damaging 1.00
nd7 UTSW 11 59555875 missense possibly damaging 0.89
Nd9 UTSW 11 59549354 missense probably damaging 1.00
Park2 UTSW 11 59565128 nonsense probably null
Park3 UTSW 11 59565850 missense probably benign 0.02
Park4 UTSW 11 59549531 missense probably benign 0.19
Park5 UTSW 11 59548476 missense probably damaging 0.99
Park6 UTSW 11 59549036 missense probably damaging 1.00
Park7 UTSW 11 59548010 nonsense probably null
Park8 UTSW 11 59566199 missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59565128 nonsense probably null
R0362:Nlrp3 UTSW 11 59548797 missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59555924 splice site probably benign
R0649:Nlrp3 UTSW 11 59548542 missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59548256 missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59565850 missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59555768 missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59549531 missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59548476 missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59543123 missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59543351 missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59558402 missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59548916 missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59549036 missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59549136 missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59549661 missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59548010 nonsense probably null
R4540:Nlrp3 UTSW 11 59551899 missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59549222 missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59548301 missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59549238 missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59566199 missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59565084 missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59549063 missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59555748 nonsense probably null
R5869:Nlrp3 UTSW 11 59548134 missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59546852 missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59546791 missense probably benign
R5979:Nlrp3 UTSW 11 59548971 missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59548566 missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59565192 missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59548446 missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59548086 missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59565066 missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59543003 splice site probably null
R7916:Nlrp3 UTSW 11 59551863 missense probably benign 0.00
R8360:Nlrp3 UTSW 11 59549403 missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59551790 missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59549271 missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59549390 missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59565044 missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59548758 missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59543315 missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59549322 missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59558552 frame shift probably null
RF040:Nlrp3 UTSW 11 59558552 frame shift probably null
Z1088:Nlrp3 UTSW 11 59551860 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GCCTCTCTGCTCATAACGAC -3'
(R):5'- AAATTCCATCCGCAGCCAGTG -3'

Sequencing Primer
(F):5'- TCTCTGCTCATAACGACGAGGC -3'
(R):5'- TCAGAGAAGAGATGCTCCTCAATGC -3'
Posted On 2020-07-13