Incidental Mutation 'R8222:Aldh18a1'
ID636793
Institutional Source Beutler Lab
Gene Symbol Aldh18a1
Ensembl Gene ENSMUSG00000025007
Gene Namealdehyde dehydrogenase 18 family, member A1
Synonyms2810433K04Rik, Pycs
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8222 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40550257-40588463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40573852 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 243 (V243I)
Ref Sequence ENSEMBL: ENSMUSP00000025979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025979] [ENSMUST00000149476] [ENSMUST00000175932] [ENSMUST00000176939] [ENSMUST00000176955]
Predicted Effect probably benign
Transcript: ENSMUST00000025979
AA Change: V243I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025979
Gene: ENSMUSG00000025007
AA Change: V243I

DomainStartEndE-ValueType
Pfam:AA_kinase 71 329 1e-41 PFAM
Pfam:Aldedh 350 659 3.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149476
SMART Domains Protein: ENSMUSP00000115429
Gene: ENSMUSG00000025007

DomainStartEndE-ValueType
Pfam:AA_kinase 71 173 3.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175932
Predicted Effect probably benign
Transcript: ENSMUST00000176939
AA Change: V241I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135426
Gene: ENSMUSG00000025007
AA Change: V241I

DomainStartEndE-ValueType
Pfam:AA_kinase 71 327 1.9e-39 PFAM
Pfam:Aldedh 351 665 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176955
SMART Domains Protein: ENSMUSP00000135759
Gene: ENSMUSG00000025007

DomainStartEndE-ValueType
PDB:4Q1T|D 1 83 1e-5 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aldehyde dehydrogenase family and encodes a bifunctional ATP- and NADPH-dependent mitochondrial enzyme with both gamma-glutamyl kinase and gamma-glutamyl phosphate reductase activities. The encoded protein catalyzes the reduction of glutamate to delta1-pyrroline-5-carboxylate, a critical step in the de novo biosynthesis of proline, ornithine and arginine. Mutations in this gene lead to hyperammonemia, hypoornithinemia, hypocitrullinemia, hypoargininemia and hypoprolinemia and may be associated with neurodegeneration, cataracts and connective tissue diseases. Alternatively spliced transcript variants, encoding different isoforms, have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 A T 8: 122,895,608 S481T probably damaging Het
Atg2b A G 12: 105,652,216 I859T possibly damaging Het
B4galt3 G A 1: 171,272,683 R141Q possibly damaging Het
Bace1 T C 9: 45,857,193 V262A probably damaging Het
BC106179 A T 16: 23,224,305 I47N noncoding transcript Het
Brpf1 C T 6: 113,310,038 P76S probably benign Het
Cdk1 A G 10: 69,340,596 V227A probably benign Het
Ceacam20 T C 7: 19,971,693 V203A probably benign Het
Cma2 T C 14: 55,973,270 V194A probably benign Het
Cnnm4 A G 1: 36,506,536 D749G probably benign Het
Cyp11b2 T C 15: 74,856,210 T8A probably benign Het
Dlk2 A G 17: 46,302,458 H170R probably benign Het
E330021D16Rik A G 6: 136,400,884 I316T probably damaging Het
Esyt1 C T 10: 128,511,778 R987Q possibly damaging Het
Ganc T C 2: 120,446,452 I665T probably damaging Het
Gas6 T C 8: 13,470,276 T471A probably benign Het
Gm13084 A T 4: 143,810,323 D479E possibly damaging Het
Grik2 A G 10: 49,573,648 F153L probably benign Het
Heatr5b A G 17: 78,801,701 V1043A possibly damaging Het
Ipo5 A G 14: 120,920,002 D84G probably benign Het
Irak4 T A 15: 94,561,229 probably null Het
Lrp4 T A 2: 91,474,741 C238S probably damaging Het
Mau2 A T 8: 70,033,177 probably null Het
Mdn1 T C 4: 32,707,477 F1589L probably benign Het
Mlxip T G 5: 123,447,533 S662A probably benign Het
Mn1 A T 5: 111,418,680 N172I probably damaging Het
Mup2 A C 4: 60,138,454 D79E probably benign Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Nlrp3 A G 11: 59,548,788 E397G probably damaging Het
Odf2l A G 3: 145,128,038 E153G probably damaging Het
Olfr1156 T C 2: 87,949,444 N263S probably benign Het
Olfr1163 T A 2: 88,071,037 Y115F probably benign Het
Olfr561 G T 7: 102,774,892 D123Y probably damaging Het
Olfr62 T C 4: 118,665,916 L133P probably damaging Het
Pkdrej T A 15: 85,817,439 H1432L probably benign Het
Plec C T 15: 76,179,174 R2232H possibly damaging Het
Polk T C 13: 96,495,515 M317V possibly damaging Het
Prdm9 A G 17: 15,544,773 S582P possibly damaging Het
R3hcc1l T A 19: 42,576,177 L643H probably damaging Het
Rassf8 G A 6: 145,820,057 V38M unknown Het
Reln G A 5: 21,931,477 Q2518* probably null Het
Sel1l3 A G 5: 53,187,954 probably null Het
Serpina3m A T 12: 104,392,701 D324V possibly damaging Het
Slc12a6 T A 2: 112,339,525 probably null Het
Slc25a3 A G 10: 91,118,191 W219R probably damaging Het
Smek1 A G 12: 101,041,905 S758P probably benign Het
Sort1 T A 3: 108,334,635 V299E probably benign Het
Stx6 A G 1: 155,198,143 D233G possibly damaging Het
Tefm A G 11: 80,140,404 V2A Het
Tfdp2 T C 9: 96,310,613 S190P possibly damaging Het
Tmprss7 A T 16: 45,658,098 I755N probably damaging Het
Trpm8 A G 1: 88,325,668 probably null Het
Ugt2a2 A G 5: 87,460,510 L490P probably damaging Het
Utp20 A G 10: 88,778,372 L1240P probably damaging Het
Vmn1r159 G T 7: 22,843,183 Y141* probably null Het
Vmn2r56 T A 7: 12,711,033 Y431F probably benign Het
Wdr66 T A 5: 123,302,423 Y1091N probably damaging Het
Other mutations in Aldh18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Aldh18a1 APN 19 40569181 splice site probably benign
IGL02353:Aldh18a1 APN 19 40577920 missense probably damaging 0.98
IGL02360:Aldh18a1 APN 19 40577920 missense probably damaging 0.98
IGL02974:Aldh18a1 APN 19 40569084 missense probably damaging 0.96
IGL03295:Aldh18a1 APN 19 40562942 missense probably damaging 1.00
PIT4498001:Aldh18a1 UTSW 19 40574356 missense probably benign
R0267:Aldh18a1 UTSW 19 40573789 missense probably benign 0.25
R0498:Aldh18a1 UTSW 19 40574272 missense probably benign 0.29
R1140:Aldh18a1 UTSW 19 40574285 missense probably benign 0.01
R1142:Aldh18a1 UTSW 19 40551213 missense probably damaging 0.97
R1509:Aldh18a1 UTSW 19 40557483 missense probably damaging 0.98
R1640:Aldh18a1 UTSW 19 40585499 missense probably benign
R1721:Aldh18a1 UTSW 19 40564838 missense probably damaging 1.00
R3012:Aldh18a1 UTSW 19 40557691 nonsense probably null
R3085:Aldh18a1 UTSW 19 40574369 missense probably benign
R3815:Aldh18a1 UTSW 19 40570500 missense probably damaging 1.00
R3863:Aldh18a1 UTSW 19 40551314 missense probably damaging 1.00
R4156:Aldh18a1 UTSW 19 40551281 missense probably damaging 1.00
R5116:Aldh18a1 UTSW 19 40553505 missense probably benign
R5135:Aldh18a1 UTSW 19 40554817 intron probably benign
R5393:Aldh18a1 UTSW 19 40585567 missense probably benign 0.00
R5492:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5493:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5494:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5957:Aldh18a1 UTSW 19 40570537 nonsense probably null
R6255:Aldh18a1 UTSW 19 40580043 missense possibly damaging 0.93
R6320:Aldh18a1 UTSW 19 40570561 missense probably benign 0.44
R6358:Aldh18a1 UTSW 19 40577678 missense possibly damaging 0.83
R6379:Aldh18a1 UTSW 19 40577770 critical splice donor site probably null
R6785:Aldh18a1 UTSW 19 40568344 missense probably damaging 1.00
R7334:Aldh18a1 UTSW 19 40551252 missense probably damaging 1.00
R7549:Aldh18a1 UTSW 19 40564847 missense probably damaging 1.00
R7935:Aldh18a1 UTSW 19 40573782 nonsense probably null
R7960:Aldh18a1 UTSW 19 40557820 missense probably benign 0.03
R8152:Aldh18a1 UTSW 19 40565012 missense probably benign 0.01
R8179:Aldh18a1 UTSW 19 40557508 missense probably damaging 1.00
R8181:Aldh18a1 UTSW 19 40557437 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AAACATCATCTGCGCATGCC -3'
(R):5'- TGGCTTAGACGATGCTGTGC -3'

Sequencing Primer
(F):5'- TCCAGTTCACGTGGCTTAGGAAC -3'
(R):5'- TGCGCATGGCTTAGAGCTC -3'
Posted On2020-07-13