Incidental Mutation 'R8223:Smok3c'
ID 636817
Institutional Source Beutler Lab
Gene Symbol Smok3c
Ensembl Gene ENSMUSG00000075598
Gene Name sperm motility kinase 3C
Synonyms EG622486
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock # R8223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 138053194-138066537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 138065393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 381 (S381P)
Ref Sequence ENSEMBL: ENSMUSP00000141020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110967] [ENSMUST00000178402]
AlphaFold A0A087WSF2
Predicted Effect probably benign
Transcript: ENSMUST00000110967
AA Change: S381P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141020
Gene: ENSMUSG00000075598
AA Change: S381P

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178402
AA Change: S381P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140749
Gene: ENSMUSG00000075598
AA Change: S381P

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 T A 17: 57,361,692 W18R probably damaging Het
Alms1 T A 6: 85,643,240 Y2417* probably null Het
Apold1 T A 6: 134,984,185 S201T probably benign Het
Arhgap31 G A 16: 38,603,722 P661S probably benign Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Cacfd1 T C 2: 27,018,384 V110A possibly damaging Het
Capn2 A G 1: 182,482,534 probably null Het
Chadl T C 15: 81,695,134 E98G possibly damaging Het
Crxos T C 7: 15,897,469 Y31H probably benign Het
Cyp4f14 A C 17: 32,911,653 probably null Het
Cyp4f39 T C 17: 32,470,865 I95T probably benign Het
Dars T C 1: 128,372,224 E341G probably benign Het
Dchs1 G T 7: 105,762,617 R1431S possibly damaging Het
Dopey1 T A 9: 86,518,292 H1001Q probably damaging Het
Efemp1 T C 11: 28,854,528 Y19H probably benign Het
Eml1 T G 12: 108,536,310 F726V probably benign Het
Fdx1 A T 9: 51,948,621 D136E probably benign Het
Ganab A T 19: 8,910,828 D446V probably damaging Het
Gusb A G 5: 129,990,112 V561A probably benign Het
Hcn1 A T 13: 117,873,870 D328V unknown Het
Hdgfl1 A G 13: 26,770,064 Y9H probably damaging Het
Hes3 T A 4: 152,287,115 S101C probably damaging Het
Igkv2-112 T C 6: 68,220,595 S84P probably benign Het
Ints9 C T 14: 65,020,360 P330S possibly damaging Het
Kdm7a A T 6: 39,149,301 N583K probably damaging Het
Klhl10 C T 11: 100,447,401 T322M probably damaging Het
Kmt2c A T 5: 25,324,218 V1545D possibly damaging Het
Laptm5 T C 4: 130,926,200 probably null Het
Ldlr A G 9: 21,747,250 T833A probably damaging Het
Llgl1 G T 11: 60,702,822 L40F possibly damaging Het
Lrrc14 T C 15: 76,714,556 L464S probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lysmd3 T A 13: 81,669,267 L121H Het
Map2 T C 1: 66,425,490 S1680P probably damaging Het
Med12l T C 3: 59,086,363 V583A possibly damaging Het
Mfsd4b5 A G 10: 39,970,250 Y445H probably damaging Het
Morf4l1 G A 9: 90,097,422 P169S probably benign Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Ola1 A G 2: 73,099,350 L303P probably damaging Het
Olfr1501 G T 19: 13,838,861 T104K probably damaging Het
Olfr348 T A 2: 36,787,397 Y291N Het
Olfr857 T C 9: 19,713,409 I194T probably benign Het
Olfr97 T C 17: 37,231,836 D178G possibly damaging Het
Pdlim3 A T 8: 45,900,525 H99L possibly damaging Het
Plagl2 G T 2: 153,231,541 T480N probably benign Het
Ptprq C T 10: 107,699,638 R422Q probably benign Het
Rad18 T A 6: 112,688,021 R51* probably null Het
Rpap3 T A 15: 97,691,304 T250S probably benign Het
Serpinb11 T C 1: 107,377,532 Y213H probably benign Het
Slc15a4 A G 5: 127,609,016 F201L possibly damaging Het
Slc25a4 A G 8: 46,210,859 S22P probably damaging Het
Slfn1 T A 11: 83,121,419 N120K probably damaging Het
Sry T A Y: 2,663,204 Q152L unknown Het
Taar2 T A 10: 23,941,350 W263R probably damaging Het
Thnsl1 T A 2: 21,212,113 V226E probably benign Het
Tmeff2 T C 1: 51,133,120 probably null Het
Tox A G 4: 6,842,408 Y41H probably damaging Het
Trank1 T A 9: 111,365,889 Y994N probably damaging Het
Trim9 C T 12: 70,251,015 A713T probably damaging Het
Tub T A 7: 109,029,326 M393K probably benign Het
Ube4a A G 9: 44,960,035 L22P possibly damaging Het
Usp47 A G 7: 112,104,376 K1165R probably damaging Het
Usp6nl T A 2: 6,430,516 I362K probably damaging Het
Vmn1r217 T C 13: 23,114,199 I178V probably benign Het
Vmn1r45 T A 6: 89,933,092 T299S probably damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Xkr8 G A 4: 132,730,935 P144L probably damaging Het
Zfpm2 T C 15: 40,752,959 I35T probably benign Het
Other mutations in Smok3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4440:Smok3c UTSW 5 138064604 missense possibly damaging 0.93
R4560:Smok3c UTSW 5 138064484 missense probably benign 0.42
R4900:Smok3c UTSW 5 138064551 missense probably damaging 1.00
R4924:Smok3c UTSW 5 138065582 nonsense probably null
R5292:Smok3c UTSW 5 138065184 missense probably damaging 1.00
R5446:Smok3c UTSW 5 138064633 missense probably damaging 1.00
R6111:Smok3c UTSW 5 138065103 missense probably damaging 0.98
R6154:Smok3c UTSW 5 138064485 missense probably benign 0.04
R6225:Smok3c UTSW 5 138065052 missense probably benign 0.15
R6759:Smok3c UTSW 5 138065437 missense probably benign 0.04
R6979:Smok3c UTSW 5 138064725 missense probably benign 0.12
R7127:Smok3c UTSW 5 138064709 missense probably damaging 0.96
R7260:Smok3c UTSW 5 138065623 missense possibly damaging 0.84
R7445:Smok3c UTSW 5 138064495 missense probably damaging 1.00
R7962:Smok3c UTSW 5 138065079 missense probably damaging 0.98
R8160:Smok3c UTSW 5 138065024 missense possibly damaging 0.91
R8381:Smok3c UTSW 5 138065562 missense probably benign
R8841:Smok3c UTSW 5 138065275 missense probably damaging 0.99
R9166:Smok3c UTSW 5 138065519 missense possibly damaging 0.61
R9369:Smok3c UTSW 5 138065508 missense probably damaging 0.98
Z1177:Smok3c UTSW 5 138064602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATATCGGGTTCCAAGCTCAAG -3'
(R):5'- CTGGACTGTGCAAAACATTGAG -3'

Sequencing Primer
(F):5'- CGGGTTCCAAGCTCAAGATATTG -3'
(R):5'- CATTGAGCAAATGCAGGGTACACTC -3'
Posted On 2020-07-13