Incidental Mutation 'R8223:Taar2'
ID636837
Institutional Source Beutler Lab
Gene Symbol Taar2
Ensembl Gene ENSMUSG00000059763
Gene Nametrace amine-associated receptor 2
SynonymsGpr58
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8223 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23938572-23941583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23941350 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 263 (W263R)
Ref Sequence ENSEMBL: ENSMUSP00000078137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079134]
Predicted Effect probably damaging
Transcript: ENSMUST00000079134
AA Change: W263R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078137
Gene: ENSMUSG00000059763
AA Change: W263R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 318 2.4e-10 PFAM
Pfam:7tm_1 48 303 2.9e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 T A 17: 57,361,692 W18R probably damaging Het
Alms1 T A 6: 85,643,240 Y2417* probably null Het
Apold1 T A 6: 134,984,185 S201T probably benign Het
Arhgap31 G A 16: 38,603,722 P661S probably benign Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Cacfd1 T C 2: 27,018,384 V110A possibly damaging Het
Capn2 A G 1: 182,482,534 probably null Het
Chadl T C 15: 81,695,134 E98G possibly damaging Het
Crxos T C 7: 15,897,469 Y31H probably benign Het
Cyp4f14 A C 17: 32,911,653 probably null Het
Cyp4f39 T C 17: 32,470,865 I95T probably benign Het
Dars T C 1: 128,372,224 E341G probably benign Het
Dchs1 G T 7: 105,762,617 R1431S possibly damaging Het
Dopey1 T A 9: 86,518,292 H1001Q probably damaging Het
Efemp1 T C 11: 28,854,528 Y19H probably benign Het
Eml1 T G 12: 108,536,310 F726V probably benign Het
Fdx1 A T 9: 51,948,621 D136E probably benign Het
Ganab A T 19: 8,910,828 D446V probably damaging Het
Gusb A G 5: 129,990,112 V561A probably benign Het
Hcn1 A T 13: 117,873,870 D328V unknown Het
Hdgfl1 A G 13: 26,770,064 Y9H probably damaging Het
Hes3 T A 4: 152,287,115 S101C probably damaging Het
Igkv2-112 T C 6: 68,220,595 S84P probably benign Het
Ints9 C T 14: 65,020,360 P330S possibly damaging Het
Kdm7a A T 6: 39,149,301 N583K probably damaging Het
Klhl10 C T 11: 100,447,401 T322M probably damaging Het
Kmt2c A T 5: 25,324,218 V1545D possibly damaging Het
Laptm5 T C 4: 130,926,200 probably null Het
Ldlr A G 9: 21,747,250 T833A probably damaging Het
Llgl1 G T 11: 60,702,822 L40F possibly damaging Het
Lrrc14 T C 15: 76,714,556 L464S probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lysmd3 T A 13: 81,669,267 L121H Het
Map2 T C 1: 66,425,490 S1680P probably damaging Het
Med12l T C 3: 59,086,363 V583A possibly damaging Het
Mfsd4b5 A G 10: 39,970,250 Y445H probably damaging Het
Morf4l1 G A 9: 90,097,422 P169S probably benign Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Ola1 A G 2: 73,099,350 L303P probably damaging Het
Olfr1501 G T 19: 13,838,861 T104K probably damaging Het
Olfr348 T A 2: 36,787,397 Y291N Het
Olfr857 T C 9: 19,713,409 I194T probably benign Het
Olfr97 T C 17: 37,231,836 D178G possibly damaging Het
Pdlim3 A T 8: 45,900,525 H99L possibly damaging Het
Plagl2 G T 2: 153,231,541 T480N probably benign Het
Ptprq C T 10: 107,699,638 R422Q probably benign Het
Rad18 T A 6: 112,688,021 R51* probably null Het
Rpap3 T A 15: 97,691,304 T250S probably benign Het
Serpinb11 T C 1: 107,377,532 Y213H probably benign Het
Slc15a4 A G 5: 127,609,016 F201L possibly damaging Het
Slc25a4 A G 8: 46,210,859 S22P probably damaging Het
Slfn1 T A 11: 83,121,419 N120K probably damaging Het
Smok3c T C 5: 138,065,393 S381P probably benign Het
Sry T A Y: 2,663,204 Q152L unknown Het
Thnsl1 T A 2: 21,212,113 V226E probably benign Het
Tmeff2 T C 1: 51,133,120 probably null Het
Tox A G 4: 6,842,408 Y41H probably damaging Het
Trank1 T A 9: 111,365,889 Y994N probably damaging Het
Trim9 C T 12: 70,251,015 A713T probably damaging Het
Tub T A 7: 109,029,326 M393K probably benign Het
Ube4a A G 9: 44,960,035 L22P possibly damaging Het
Usp47 A G 7: 112,104,376 K1165R probably damaging Het
Usp6nl T A 2: 6,430,516 I362K probably damaging Het
Vmn1r217 T C 13: 23,114,199 I178V probably benign Het
Vmn1r45 T A 6: 89,933,092 T299S probably damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Xkr8 G A 4: 132,730,935 P144L probably damaging Het
Zfpm2 T C 15: 40,752,959 I35T probably benign Het
Other mutations in Taar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Taar2 APN 10 23941368 missense possibly damaging 0.50
IGL00807:Taar2 APN 10 23940675 missense probably benign 0.00
IGL01346:Taar2 APN 10 23941099 missense probably damaging 1.00
IGL01433:Taar2 APN 10 23940759 missense probably benign 0.02
IGL01782:Taar2 APN 10 23941144 missense probably damaging 1.00
IGL03106:Taar2 APN 10 23941297 missense probably damaging 0.99
IGL03372:Taar2 APN 10 23941171 missense probably benign 0.03
R0046:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0046:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0090:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0101:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0101:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0103:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0157:Taar2 UTSW 10 23941491 missense probably damaging 1.00
R0189:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0190:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0226:Taar2 UTSW 10 23941063 missense probably damaging 1.00
R0226:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0265:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0267:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0349:Taar2 UTSW 10 23941429 missense possibly damaging 0.79
R0349:Taar2 UTSW 10 23941509 missense probably benign 0.01
R0426:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0556:Taar2 UTSW 10 23940895 missense probably damaging 1.00
R0698:Taar2 UTSW 10 23941495 missense probably benign 0.00
R1191:Taar2 UTSW 10 23941029 missense probably damaging 1.00
R2919:Taar2 UTSW 10 23941556 missense probably benign 0.00
R4615:Taar2 UTSW 10 23941365 missense probably benign 0.43
R4658:Taar2 UTSW 10 23941503 missense probably benign 0.04
R4766:Taar2 UTSW 10 23940771 missense probably damaging 0.98
R4872:Taar2 UTSW 10 23940693 missense probably benign 0.02
R5205:Taar2 UTSW 10 23940976 missense probably benign 0.42
R5271:Taar2 UTSW 10 23941032 missense probably damaging 0.97
R5517:Taar2 UTSW 10 23940729 missense possibly damaging 0.92
R6033:Taar2 UTSW 10 23940976 missense probably benign
R6033:Taar2 UTSW 10 23940976 missense probably benign
R6325:Taar2 UTSW 10 23940717 missense probably benign 0.05
R6398:Taar2 UTSW 10 23941279 missense probably benign 0.00
R6762:Taar2 UTSW 10 23941402 missense probably damaging 0.98
R7121:Taar2 UTSW 10 23940827 missense probably damaging 1.00
R7209:Taar2 UTSW 10 23940699 missense possibly damaging 0.57
R7709:Taar2 UTSW 10 23940723 missense probably benign 0.00
R8045:Taar2 UTSW 10 23941488 missense probably damaging 1.00
Z1176:Taar2 UTSW 10 23941186 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCATGTTCAACAAGCTATGGGG -3'
(R):5'- GCGAGCTGAAAATTTTACCCAG -3'

Sequencing Primer
(F):5'- CCACCTTGTTTGTGGCAGGC -3'
(R):5'- CCCAGTAAAATGTACTTGAGTGCTC -3'
Posted On2020-07-13