Incidental Mutation 'R8223:Zfpm2'
ID 636852
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms FOG2, B330005D23Rik, FOG-2
MMRRC Submission 067641-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 40518438-40967988 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40616355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 35 (I35T)
Ref Sequence ENSEMBL: ENSMUSP00000051335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467]
AlphaFold Q8CCH7
Predicted Effect probably benign
Transcript: ENSMUST00000053467
AA Change: I35T

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: I35T

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 T A 17: 57,668,692 (GRCm39) W18R probably damaging Het
Alms1 T A 6: 85,620,222 (GRCm39) Y2417* probably null Het
Apold1 T A 6: 134,961,148 (GRCm39) S201T probably benign Het
Arhgap31 G A 16: 38,424,084 (GRCm39) P661S probably benign Het
Cacfd1 T C 2: 26,908,396 (GRCm39) V110A possibly damaging Het
Capn2 A G 1: 182,310,099 (GRCm39) probably null Het
Chadl T C 15: 81,579,335 (GRCm39) E98G possibly damaging Het
Crxos T C 7: 15,631,394 (GRCm39) Y31H probably benign Het
Cyp4f14 A C 17: 33,130,627 (GRCm39) probably null Het
Cyp4f39 T C 17: 32,689,839 (GRCm39) I95T probably benign Het
Dars1 T C 1: 128,299,961 (GRCm39) E341G probably benign Het
Dchs1 G T 7: 105,411,824 (GRCm39) R1431S possibly damaging Het
Dop1a T A 9: 86,400,345 (GRCm39) H1001Q probably damaging Het
Efemp1 T C 11: 28,804,528 (GRCm39) Y19H probably benign Het
Eml1 T G 12: 108,502,569 (GRCm39) F726V probably benign Het
Fdx1 A T 9: 51,859,921 (GRCm39) D136E probably benign Het
Ganab A T 19: 8,888,192 (GRCm39) D446V probably damaging Het
Gusb A G 5: 130,018,953 (GRCm39) V561A probably benign Het
Hcn1 A T 13: 118,010,406 (GRCm39) D328V unknown Het
Hdgfl1 A G 13: 26,954,047 (GRCm39) Y9H probably damaging Het
Hes3 T A 4: 152,371,572 (GRCm39) S101C probably damaging Het
Igkv2-112 T C 6: 68,197,579 (GRCm39) S84P probably benign Het
Ints9 C T 14: 65,257,809 (GRCm39) P330S possibly damaging Het
Kdm7a A T 6: 39,126,235 (GRCm39) N583K probably damaging Het
Klhl10 C T 11: 100,338,227 (GRCm39) T322M probably damaging Het
Kmt2c A T 5: 25,529,216 (GRCm39) V1545D possibly damaging Het
Laptm5 T C 4: 130,653,511 (GRCm39) probably null Het
Ldlr A G 9: 21,658,546 (GRCm39) T833A probably damaging Het
Llgl1 G T 11: 60,593,648 (GRCm39) L40F possibly damaging Het
Lrrc14 T C 15: 76,598,756 (GRCm39) L464S probably damaging Het
Lrrc38 G A 4: 143,077,303 (GRCm39) G189R probably damaging Het
Lysmd3 T A 13: 81,817,386 (GRCm39) L121H Het
Map2 T C 1: 66,464,649 (GRCm39) S1680P probably damaging Het
Med12l T C 3: 58,993,784 (GRCm39) V583A possibly damaging Het
Mfsd4b5 A G 10: 39,846,246 (GRCm39) Y445H probably damaging Het
Morf4l1 G A 9: 89,979,475 (GRCm39) P169S probably benign Het
Nab2 C A 10: 127,498,645 (GRCm39) V475L probably benign Het
Ola1 A G 2: 72,929,694 (GRCm39) L303P probably damaging Het
Or1j19 T A 2: 36,677,409 (GRCm39) Y291N Het
Or1o2 T C 17: 37,542,727 (GRCm39) D178G possibly damaging Het
Or7e166 T C 9: 19,624,705 (GRCm39) I194T probably benign Het
Or9i2 G T 19: 13,816,225 (GRCm39) T104K probably damaging Het
Pdlim3 A T 8: 46,353,562 (GRCm39) H99L possibly damaging Het
Plagl2 G T 2: 153,073,461 (GRCm39) T480N probably benign Het
Pramel20 T G 4: 143,298,530 (GRCm39) Y158D probably benign Het
Ptprq C T 10: 107,535,499 (GRCm39) R422Q probably benign Het
Rad18 T A 6: 112,664,982 (GRCm39) R51* probably null Het
Rpap3 T A 15: 97,589,185 (GRCm39) T250S probably benign Het
Serpinb11 T C 1: 107,305,262 (GRCm39) Y213H probably benign Het
Slc15a4 A G 5: 127,686,080 (GRCm39) F201L possibly damaging Het
Slc25a4 A G 8: 46,663,896 (GRCm39) S22P probably damaging Het
Slfn1 T A 11: 83,012,245 (GRCm39) N120K probably damaging Het
Smok3c T C 5: 138,063,655 (GRCm39) S381P probably benign Het
Sry T A Y: 2,663,204 (GRCm39) Q152L unknown Het
Taar2 T A 10: 23,817,248 (GRCm39) W263R probably damaging Het
Thnsl1 T A 2: 21,216,924 (GRCm39) V226E probably benign Het
Tmeff2 T C 1: 51,172,279 (GRCm39) probably null Het
Tox A G 4: 6,842,408 (GRCm39) Y41H probably damaging Het
Trank1 T A 9: 111,194,957 (GRCm39) Y994N probably damaging Het
Trim9 C T 12: 70,297,789 (GRCm39) A713T probably damaging Het
Tub T A 7: 108,628,533 (GRCm39) M393K probably benign Het
Ube4a A G 9: 44,871,333 (GRCm39) L22P possibly damaging Het
Usp47 A G 7: 111,703,583 (GRCm39) K1165R probably damaging Het
Usp6nl T A 2: 6,435,327 (GRCm39) I362K probably damaging Het
Vmn1r217 T C 13: 23,298,369 (GRCm39) I178V probably benign Het
Vmn1r45 T A 6: 89,910,074 (GRCm39) T299S probably damaging Het
Vmn2r5 A T 3: 64,398,726 (GRCm39) L751* probably null Het
Xkr8 G A 4: 132,458,246 (GRCm39) P144L probably damaging Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 40,962,683 (GRCm39) missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 40,962,887 (GRCm39) missense probably benign 0.37
IGL00821:Zfpm2 APN 15 40,966,783 (GRCm39) missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 40,965,320 (GRCm39) missense probably benign 0.07
IGL01623:Zfpm2 APN 15 40,965,320 (GRCm39) missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40,616,452 (GRCm39) critical splice donor site probably null
IGL01872:Zfpm2 APN 15 40,965,783 (GRCm39) missense probably benign
IGL02087:Zfpm2 APN 15 40,966,517 (GRCm39) missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 40,965,591 (GRCm39) missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 40,962,890 (GRCm39) missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 40,962,890 (GRCm39) missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 40,962,868 (GRCm39) missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 40,965,415 (GRCm39) missense probably benign 0.23
IGL02792:Zfpm2 APN 15 40,966,409 (GRCm39) missense probably benign 0.00
IGL02861:Zfpm2 APN 15 40,966,662 (GRCm39) missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 40,964,790 (GRCm39) missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 40,966,170 (GRCm39) missense probably benign
R0305:Zfpm2 UTSW 15 40,637,431 (GRCm39) splice site probably benign
R0365:Zfpm2 UTSW 15 40,637,462 (GRCm39) missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 40,965,075 (GRCm39) missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 40,965,877 (GRCm39) missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 40,962,687 (GRCm39) missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 40,966,605 (GRCm39) missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 40,966,419 (GRCm39) missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 40,964,579 (GRCm39) missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 40,962,785 (GRCm39) missense probably benign 0.06
R2867:Zfpm2 UTSW 15 40,962,785 (GRCm39) missense probably benign 0.06
R2886:Zfpm2 UTSW 15 40,965,719 (GRCm39) missense probably benign 0.44
R3024:Zfpm2 UTSW 15 40,966,355 (GRCm39) missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40,734,023 (GRCm39) missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 40,966,940 (GRCm39) missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 40,959,557 (GRCm39) missense probably benign 0.00
R5263:Zfpm2 UTSW 15 40,962,791 (GRCm39) missense probably benign 0.45
R5266:Zfpm2 UTSW 15 40,962,865 (GRCm39) missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40,733,938 (GRCm39) missense probably benign 0.01
R5584:Zfpm2 UTSW 15 40,965,933 (GRCm39) missense probably benign 0.45
R5661:Zfpm2 UTSW 15 40,959,467 (GRCm39) nonsense probably null
R6437:Zfpm2 UTSW 15 40,962,793 (GRCm39) missense probably benign
R6660:Zfpm2 UTSW 15 40,518,981 (GRCm39) critical splice donor site probably null
R6742:Zfpm2 UTSW 15 40,965,114 (GRCm39) missense probably benign
R6749:Zfpm2 UTSW 15 40,818,104 (GRCm39) missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40,616,413 (GRCm39) missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 40,966,386 (GRCm39) missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 40,966,671 (GRCm39) missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40,818,162 (GRCm39) missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 40,959,487 (GRCm39) missense probably benign 0.03
R7893:Zfpm2 UTSW 15 40,966,008 (GRCm39) missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 40,965,644 (GRCm39) missense probably damaging 1.00
R9028:Zfpm2 UTSW 15 40,966,758 (GRCm39) missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 40,962,712 (GRCm39) missense possibly damaging 0.95
R9234:Zfpm2 UTSW 15 40,966,470 (GRCm39) missense probably damaging 1.00
R9474:Zfpm2 UTSW 15 40,966,867 (GRCm39) missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 40,965,710 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACATGTGTGACTCCCCTTGG -3'
(R):5'- TATTGTATATCAGCACTGGTCCATG -3'

Sequencing Primer
(F):5'- CCTTGGGATGACTTCCTGTAATC -3'
(R):5'- TATCAGCACTGGTCCATGCTAAGG -3'
Posted On 2020-07-13