Incidental Mutation 'R8223:Zfpm2'
ID 636852
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms B330005D23Rik, FOG2, FOG-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 40655035-41104592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40752959 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 35 (I35T)
Ref Sequence ENSEMBL: ENSMUSP00000051335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467]
AlphaFold Q8CCH7
Predicted Effect probably benign
Transcript: ENSMUST00000053467
AA Change: I35T

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: I35T

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 T A 17: 57,361,692 W18R probably damaging Het
Alms1 T A 6: 85,643,240 Y2417* probably null Het
Apold1 T A 6: 134,984,185 S201T probably benign Het
Arhgap31 G A 16: 38,603,722 P661S probably benign Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Cacfd1 T C 2: 27,018,384 V110A possibly damaging Het
Capn2 A G 1: 182,482,534 probably null Het
Chadl T C 15: 81,695,134 E98G possibly damaging Het
Crxos T C 7: 15,897,469 Y31H probably benign Het
Cyp4f14 A C 17: 32,911,653 probably null Het
Cyp4f39 T C 17: 32,470,865 I95T probably benign Het
Dars T C 1: 128,372,224 E341G probably benign Het
Dchs1 G T 7: 105,762,617 R1431S possibly damaging Het
Dopey1 T A 9: 86,518,292 H1001Q probably damaging Het
Efemp1 T C 11: 28,854,528 Y19H probably benign Het
Eml1 T G 12: 108,536,310 F726V probably benign Het
Fdx1 A T 9: 51,948,621 D136E probably benign Het
Ganab A T 19: 8,910,828 D446V probably damaging Het
Gusb A G 5: 129,990,112 V561A probably benign Het
Hcn1 A T 13: 117,873,870 D328V unknown Het
Hdgfl1 A G 13: 26,770,064 Y9H probably damaging Het
Hes3 T A 4: 152,287,115 S101C probably damaging Het
Igkv2-112 T C 6: 68,220,595 S84P probably benign Het
Ints9 C T 14: 65,020,360 P330S possibly damaging Het
Kdm7a A T 6: 39,149,301 N583K probably damaging Het
Klhl10 C T 11: 100,447,401 T322M probably damaging Het
Kmt2c A T 5: 25,324,218 V1545D possibly damaging Het
Laptm5 T C 4: 130,926,200 probably null Het
Ldlr A G 9: 21,747,250 T833A probably damaging Het
Llgl1 G T 11: 60,702,822 L40F possibly damaging Het
Lrrc14 T C 15: 76,714,556 L464S probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lysmd3 T A 13: 81,669,267 L121H Het
Map2 T C 1: 66,425,490 S1680P probably damaging Het
Med12l T C 3: 59,086,363 V583A possibly damaging Het
Mfsd4b5 A G 10: 39,970,250 Y445H probably damaging Het
Morf4l1 G A 9: 90,097,422 P169S probably benign Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Ola1 A G 2: 73,099,350 L303P probably damaging Het
Olfr1501 G T 19: 13,838,861 T104K probably damaging Het
Olfr348 T A 2: 36,787,397 Y291N Het
Olfr857 T C 9: 19,713,409 I194T probably benign Het
Olfr97 T C 17: 37,231,836 D178G possibly damaging Het
Pdlim3 A T 8: 45,900,525 H99L possibly damaging Het
Plagl2 G T 2: 153,231,541 T480N probably benign Het
Ptprq C T 10: 107,699,638 R422Q probably benign Het
Rad18 T A 6: 112,688,021 R51* probably null Het
Rpap3 T A 15: 97,691,304 T250S probably benign Het
Serpinb11 T C 1: 107,377,532 Y213H probably benign Het
Slc15a4 A G 5: 127,609,016 F201L possibly damaging Het
Slc25a4 A G 8: 46,210,859 S22P probably damaging Het
Slfn1 T A 11: 83,121,419 N120K probably damaging Het
Smok3c T C 5: 138,065,393 S381P probably benign Het
Sry T A Y: 2,663,204 Q152L unknown Het
Taar2 T A 10: 23,941,350 W263R probably damaging Het
Thnsl1 T A 2: 21,212,113 V226E probably benign Het
Tmeff2 T C 1: 51,133,120 probably null Het
Tox A G 4: 6,842,408 Y41H probably damaging Het
Trank1 T A 9: 111,365,889 Y994N probably damaging Het
Trim9 C T 12: 70,251,015 A713T probably damaging Het
Tub T A 7: 109,029,326 M393K probably benign Het
Ube4a A G 9: 44,960,035 L22P possibly damaging Het
Usp47 A G 7: 112,104,376 K1165R probably damaging Het
Usp6nl T A 2: 6,430,516 I362K probably damaging Het
Vmn1r217 T C 13: 23,114,199 I178V probably benign Het
Vmn1r45 T A 6: 89,933,092 T299S probably damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Xkr8 G A 4: 132,730,935 P144L probably damaging Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 41099287 missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 41099491 missense probably benign 0.37
IGL00821:Zfpm2 APN 15 41103387 missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01623:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40753056 critical splice donor site probably null
IGL01872:Zfpm2 APN 15 41102387 missense probably benign
IGL02087:Zfpm2 APN 15 41103121 missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 41102195 missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 41099472 missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 41102019 missense probably benign 0.23
IGL02792:Zfpm2 APN 15 41103013 missense probably benign 0.00
IGL02861:Zfpm2 APN 15 41103266 missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 41101394 missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 41102774 missense probably benign
R0305:Zfpm2 UTSW 15 40774035 splice site probably benign
R0365:Zfpm2 UTSW 15 40774066 missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 41101679 missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 41102481 missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 41099291 missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 41103209 missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 41103023 missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 41101183 missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2886:Zfpm2 UTSW 15 41102323 missense probably benign 0.44
R3024:Zfpm2 UTSW 15 41102959 missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40870627 missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 41103544 missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 41096161 missense probably benign 0.00
R5263:Zfpm2 UTSW 15 41099395 missense probably benign 0.45
R5266:Zfpm2 UTSW 15 41099469 missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40870542 missense probably benign 0.01
R5584:Zfpm2 UTSW 15 41102537 missense probably benign 0.45
R5661:Zfpm2 UTSW 15 41096071 nonsense probably null
R6437:Zfpm2 UTSW 15 41099397 missense probably benign
R6660:Zfpm2 UTSW 15 40655585 critical splice donor site probably null
R6742:Zfpm2 UTSW 15 41101718 missense probably benign
R6749:Zfpm2 UTSW 15 40954708 missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40753017 missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 41102990 missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 41103275 missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40954766 missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 41096091 missense probably benign 0.03
R7893:Zfpm2 UTSW 15 41102612 missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 41102248 missense probably damaging 1.00
R9028:Zfpm2 UTSW 15 41103362 missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 41099316 missense possibly damaging 0.95
R9234:Zfpm2 UTSW 15 41103074 missense probably damaging 1.00
R9474:Zfpm2 UTSW 15 41103471 missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 41102314 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACATGTGTGACTCCCCTTGG -3'
(R):5'- TATTGTATATCAGCACTGGTCCATG -3'

Sequencing Primer
(F):5'- CCTTGGGATGACTTCCTGTAATC -3'
(R):5'- TATCAGCACTGGTCCATGCTAAGG -3'
Posted On 2020-07-13