Incidental Mutation 'R8224:Ppp1r12b'
ID636867
Institutional Source Beutler Lab
Gene Symbol Ppp1r12b
Ensembl Gene ENSMUSG00000073557
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12B
Synonyms9530009M10Rik, 1810037O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R8224 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location134754658-134955942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134902462 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 113 (N113S)
Ref Sequence ENSEMBL: ENSMUSP00000131406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045665] [ENSMUST00000086444] [ENSMUST00000168381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045665
AA Change: N113S

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047463
Gene: ENSMUSG00000073557
AA Change: N113S

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 2.45e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 2.45e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086444
AA Change: N113S

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000083633
Gene: ENSMUSG00000073557
AA Change: N113S

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
Pfam:PRKG1_interact 875 982 4.6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168381
AA Change: N113S

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131406
Gene: ENSMUSG00000073557
AA Change: N113S

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 986 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,218,253 E45V probably damaging Het
Adamts9 A T 6: 92,796,370 V1754D probably damaging Het
Ankrd26 G A 6: 118,525,755 T818M probably damaging Het
Card11 T C 5: 140,902,877 E242G possibly damaging Het
Cdh7 G T 1: 109,994,203 L8F probably benign Het
Cenpa T C 5: 30,673,355 probably benign Het
Cfap61 T C 2: 145,939,880 V11A probably benign Het
Chfr T A 5: 110,160,243 probably null Het
Col14a1 A T 15: 55,407,741 Y630F unknown Het
Cst10 A G 2: 149,409,982 N126D possibly damaging Het
Cubn T C 2: 13,349,877 T1903A probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Fam21 A C 6: 116,241,496 K634T probably damaging Het
Gon4l A G 3: 88,895,142 E1020G probably damaging Het
Gp1ba A G 11: 70,639,857 N150D unknown Het
Gstm2 T C 3: 107,983,998 I169V probably benign Het
Ighv1-75 A T 12: 115,834,239 V21D probably benign Het
Il7 T C 3: 7,577,248 M51V possibly damaging Het
Insm2 A T 12: 55,599,978 D169V probably damaging Het
Jmjd1c A G 10: 67,244,849 D373G noncoding transcript Het
Kif16b T C 2: 142,834,088 N431D probably benign Het
Kmt2a A C 9: 44,808,029 I3925S unknown Het
Lgi4 G A 7: 31,063,592 C164Y probably damaging Het
Lrfn5 A T 12: 61,843,406 I494F possibly damaging Het
Map9 T C 3: 82,359,063 I5T probably benign Het
Ncf2 T C 1: 152,830,393 V252A possibly damaging Het
Nlrp4g A T 9: 124,353,374 I573F noncoding transcript Het
Nrn1 G A 13: 36,734,284 L3F probably damaging Het
Olfr192 A T 16: 59,098,754 D79E unknown Het
Olfr374 A G 8: 72,110,379 D271G noncoding transcript Het
Olfr715 T A 7: 107,128,872 I174F probably damaging Het
Olfr767 A G 10: 129,079,435 F176S possibly damaging Het
Otop1 C A 5: 38,300,503 T535K possibly damaging Het
Pacs2 A G 12: 113,059,760 T333A probably damaging Het
Pax3 T C 1: 78,121,690 Y354C probably damaging Het
Phlpp1 T C 1: 106,392,618 S1448P probably damaging Het
Pias4 C A 10: 81,167,731 probably benign Het
Ptpn12 G T 5: 20,998,658 P374Q probably damaging Het
Reg4 A T 3: 98,224,695 probably benign Het
Sh3bp5 T C 14: 31,377,516 D256G probably damaging Het
Slc25a32 C G 15: 39,112,620 probably benign Het
Tnip2 C T 5: 34,513,659 R80Q possibly damaging Het
Uroc1 A G 6: 90,344,067 probably null Het
Xpot A T 10: 121,607,608 Y405N probably damaging Het
Yes1 T C 5: 32,659,073 Y365H probably benign Het
Zfp607a A T 7: 27,878,111 E202V probably damaging Het
Zfp932 T C 5: 109,996,614 probably benign Het
Zfp947 A C 17: 22,145,382 M437R probably benign Het
Zscan10 A G 17: 23,609,392 T303A probably benign Het
Other mutations in Ppp1r12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Ppp1r12b APN 1 134892159 missense probably damaging 1.00
IGL01788:Ppp1r12b APN 1 134893507 missense possibly damaging 0.66
IGL01880:Ppp1r12b APN 1 134886421 critical splice donor site probably null
IGL02109:Ppp1r12b APN 1 134872805 critical splice donor site probably null
IGL02247:Ppp1r12b APN 1 134835983 missense probably benign
IGL02336:Ppp1r12b APN 1 134886506 missense probably damaging 1.00
IGL02903:Ppp1r12b APN 1 134955649 missense probably benign
IGL02963:Ppp1r12b APN 1 134886548 missense probably damaging 1.00
IGL03074:Ppp1r12b APN 1 134836020 missense probably benign 0.01
IGL03302:Ppp1r12b APN 1 134838050 splice site probably benign
R0102:Ppp1r12b UTSW 1 134835899 critical splice acceptor site probably null
R0102:Ppp1r12b UTSW 1 134835899 critical splice acceptor site probably null
R0189:Ppp1r12b UTSW 1 134865776 critical splice donor site probably null
R0556:Ppp1r12b UTSW 1 134777322 missense probably damaging 1.00
R0594:Ppp1r12b UTSW 1 134776479 missense probably damaging 1.00
R0690:Ppp1r12b UTSW 1 134876082 missense probably damaging 1.00
R1354:Ppp1r12b UTSW 1 134835983 missense probably benign 0.42
R1676:Ppp1r12b UTSW 1 134777452 missense probably damaging 1.00
R1775:Ppp1r12b UTSW 1 134893348 critical splice donor site probably null
R1839:Ppp1r12b UTSW 1 134837981 missense probably benign 0.32
R1946:Ppp1r12b UTSW 1 134892270 missense probably damaging 1.00
R1971:Ppp1r12b UTSW 1 134865913 missense probably benign 0.00
R1997:Ppp1r12b UTSW 1 134846355 intron probably benign
R3110:Ppp1r12b UTSW 1 134872832 missense probably damaging 1.00
R3112:Ppp1r12b UTSW 1 134872832 missense probably damaging 1.00
R3908:Ppp1r12b UTSW 1 134842732 missense probably damaging 1.00
R3912:Ppp1r12b UTSW 1 134887318 missense probably damaging 1.00
R3977:Ppp1r12b UTSW 1 134765975 missense probably benign 0.00
R4243:Ppp1r12b UTSW 1 134782108 intron probably benign
R4835:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4836:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4843:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4854:Ppp1r12b UTSW 1 134873951 missense probably damaging 1.00
R4870:Ppp1r12b UTSW 1 134949033 missense probably benign 0.00
R4881:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5024:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5054:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5055:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5056:Ppp1r12b UTSW 1 134834392 intron probably benign
R5056:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5158:Ppp1r12b UTSW 1 134886428 missense probably damaging 1.00
R5599:Ppp1r12b UTSW 1 134865907 missense probably benign 0.08
R5771:Ppp1r12b UTSW 1 134773424 critical splice donor site probably null
R5775:Ppp1r12b UTSW 1 134876042 missense probably benign
R5872:Ppp1r12b UTSW 1 134776406 missense probably benign 0.03
R5896:Ppp1r12b UTSW 1 134765981 missense probably damaging 1.00
R6060:Ppp1r12b UTSW 1 134955524 missense possibly damaging 0.82
R6129:Ppp1r12b UTSW 1 134892252 nonsense probably null
R6369:Ppp1r12b UTSW 1 134886542 missense possibly damaging 0.93
R6868:Ppp1r12b UTSW 1 134886438 missense probably benign 0.00
R7681:Ppp1r12b UTSW 1 134865935 missense probably benign 0.02
R7940:Ppp1r12b UTSW 1 134876055 missense probably benign 0.00
R8057:Ppp1r12b UTSW 1 134955616 missense probably damaging 1.00
R8070:Ppp1r12b UTSW 1 134876069 missense probably benign 0.06
R8134:Ppp1r12b UTSW 1 134886542 missense possibly damaging 0.93
R8147:Ppp1r12b UTSW 1 134873942 missense possibly damaging 0.78
R8270:Ppp1r12b UTSW 1 134876148 missense probably benign 0.37
R8304:Ppp1r12b UTSW 1 134896363 missense possibly damaging 0.65
X0022:Ppp1r12b UTSW 1 134835873 missense probably benign 0.00
X0027:Ppp1r12b UTSW 1 134896354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGCACAGTGTCAGCTAG -3'
(R):5'- CAGCACTGTAGAGATCATTTCATAG -3'

Sequencing Primer
(F):5'- GCACAGTGTCAGCTAGCTCTTAATAG -3'
(R):5'- CTAATAGTGCTTCTAAGTTGGAAGTC -3'
Posted On2020-07-13