Incidental Mutation 'R8224:Chfr'
ID 636883
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Name checkpoint with forkhead and ring finger domains
Synonyms RNF116, 5730484M20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R8224 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110135842-110171972 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 110160243 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]
AlphaFold Q810L3
Predicted Effect probably null
Transcript: ENSMUST00000014812
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112519
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect probably null
Transcript: ENSMUST00000198633
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199672
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,218,253 E45V probably damaging Het
Adamts9 A T 6: 92,796,370 V1754D probably damaging Het
Ankrd26 G A 6: 118,525,755 T818M probably damaging Het
Card11 T C 5: 140,902,877 E242G possibly damaging Het
Cdh7 G T 1: 109,994,203 L8F probably benign Het
Cenpa T C 5: 30,673,355 probably benign Het
Cfap61 T C 2: 145,939,880 V11A probably benign Het
Col14a1 A T 15: 55,407,741 Y630F unknown Het
Cst10 A G 2: 149,409,982 N126D possibly damaging Het
Cubn T C 2: 13,349,877 T1903A probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Fam21 A C 6: 116,241,496 K634T probably damaging Het
Gon4l A G 3: 88,895,142 E1020G probably damaging Het
Gp1ba A G 11: 70,639,857 N150D unknown Het
Gstm2 T C 3: 107,983,998 I169V probably benign Het
Ighv1-75 A T 12: 115,834,239 V21D probably benign Het
Il7 T C 3: 7,577,248 M51V possibly damaging Het
Insm2 A T 12: 55,599,978 D169V probably damaging Het
Jmjd1c A G 10: 67,244,849 D373G noncoding transcript Het
Kif16b T C 2: 142,834,088 N431D probably benign Het
Kmt2a A C 9: 44,808,029 I3925S unknown Het
Lgi4 G A 7: 31,063,592 C164Y probably damaging Het
Lrfn5 A T 12: 61,843,406 I494F possibly damaging Het
Map9 T C 3: 82,359,063 I5T probably benign Het
Ncf2 T C 1: 152,830,393 V252A possibly damaging Het
Nlrp4g A T 9: 124,353,374 I573F noncoding transcript Het
Nrn1 G A 13: 36,734,284 L3F probably damaging Het
Olfr192 A T 16: 59,098,754 D79E unknown Het
Olfr374 A G 8: 72,110,379 D271G noncoding transcript Het
Olfr715 T A 7: 107,128,872 I174F probably damaging Het
Olfr767 A G 10: 129,079,435 F176S possibly damaging Het
Otop1 C A 5: 38,300,503 T535K possibly damaging Het
Pacs2 A G 12: 113,059,760 T333A probably damaging Het
Pax3 T C 1: 78,121,690 Y354C probably damaging Het
Phlpp1 T C 1: 106,392,618 S1448P probably damaging Het
Pias4 C A 10: 81,167,731 probably benign Het
Ppp1r12b T C 1: 134,902,462 N113S probably benign Het
Ptpn12 G T 5: 20,998,658 P374Q probably damaging Het
Reg4 A T 3: 98,224,695 probably benign Het
Sh3bp5 T C 14: 31,377,516 D256G probably damaging Het
Slc25a32 C G 15: 39,112,620 probably benign Het
Tnip2 C T 5: 34,513,659 R80Q possibly damaging Het
Uroc1 A G 6: 90,344,067 probably null Het
Xpot A T 10: 121,607,608 Y405N probably damaging Het
Yes1 T C 5: 32,659,073 Y365H probably benign Het
Zfp607a A T 7: 27,878,111 E202V probably damaging Het
Zfp932 T C 5: 109,996,614 probably benign Het
Zfp947 A C 17: 22,145,382 M437R probably benign Het
Zscan10 A G 17: 23,609,392 T303A probably benign Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110143573 missense possibly damaging 0.94
IGL01479:Chfr APN 5 110144993 unclassified probably benign
IGL02543:Chfr APN 5 110143547 splice site probably null
IGL02657:Chfr APN 5 110154839 missense probably damaging 1.00
IGL03057:Chfr APN 5 110143609 missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110151677 missense possibly damaging 0.88
R0938:Chfr UTSW 5 110164058 missense probably damaging 1.00
R1346:Chfr UTSW 5 110140447 missense probably damaging 1.00
R1561:Chfr UTSW 5 110158808 missense probably benign 0.05
R1602:Chfr UTSW 5 110151665 missense probably benign 0.26
R1658:Chfr UTSW 5 110153169 missense probably damaging 1.00
R2134:Chfr UTSW 5 110144761 splice site probably null
R2234:Chfr UTSW 5 110170863 missense probably damaging 1.00
R4371:Chfr UTSW 5 110136168 missense probably damaging 0.99
R4420:Chfr UTSW 5 110170880 nonsense probably null
R4666:Chfr UTSW 5 110144867 nonsense probably null
R4742:Chfr UTSW 5 110143598 missense probably benign 0.04
R4809:Chfr UTSW 5 110158834 missense probably damaging 1.00
R5490:Chfr UTSW 5 110153129 missense possibly damaging 0.88
R5581:Chfr UTSW 5 110153282 critical splice donor site probably null
R5820:Chfr UTSW 5 110162739 missense possibly damaging 0.94
R6012:Chfr UTSW 5 110144651 critical splice donor site probably null
R7128:Chfr UTSW 5 110143636 missense probably benign 0.33
R7166:Chfr UTSW 5 110158805 missense probably benign
R7278:Chfr UTSW 5 110140360 missense probably benign 0.23
R7393:Chfr UTSW 5 110152358 missense probably damaging 0.98
R7422:Chfr UTSW 5 110162705 splice site probably null
R7499:Chfr UTSW 5 110151683 missense probably benign 0.40
R8264:Chfr UTSW 5 110152434 missense possibly damaging 0.86
R8325:Chfr UTSW 5 110162763 nonsense probably null
R8333:Chfr UTSW 5 110154937 missense probably benign 0.05
R8823:Chfr UTSW 5 110152392 missense probably damaging 0.96
R9024:Chfr UTSW 5 110158832 missense probably benign 0.26
R9419:Chfr UTSW 5 110169190 missense not run
X0013:Chfr UTSW 5 110151579 missense probably benign 0.19
Z1176:Chfr UTSW 5 110144895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGAGTCTGGTGCTAAATGTC -3'
(R):5'- TTTCTCCAGTATAGGAAAACCAGG -3'

Sequencing Primer
(F):5'- AGTCTGGTGCTAAATGTCCTCAG -3'
(R):5'- AGCAATGTGGGTTTGAGAATTTCAAG -3'
Posted On 2020-07-13