Incidental Mutation 'R8224:Card11'
ID 636884
Institutional Source Beutler Lab
Gene Symbol Card11
Ensembl Gene ENSMUSG00000036526
Gene Name caspase recruitment domain family, member 11
Synonyms 2410011D02Rik, BIMP3, CARMA1, 0610008L17Rik
MMRRC Submission 067660-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8224 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 140858745-140986337 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140888632 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 242 (E242G)
Ref Sequence ENSEMBL: ENSMUSP00000082941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085786]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000085786
AA Change: E242G

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: E242G

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.3e-23 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
PDZ 674 755 2.73e-1 SMART
Blast:SH3 776 838 1e-10 BLAST
low complexity region 839 850 N/A INTRINSIC
low complexity region 920 934 N/A INTRINSIC
SCOP:d1kjwa2 970 1149 1e-18 SMART
Blast:GuKc 973 1139 1e-102 BLAST
Meta Mutation Damage Score 0.1909 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,094,249 (GRCm39) E45V probably damaging Het
Adamts9 A T 6: 92,773,351 (GRCm39) V1754D probably damaging Het
Ankrd26 G A 6: 118,502,716 (GRCm39) T818M probably damaging Het
Cdh20 G T 1: 109,921,933 (GRCm39) L8F probably benign Het
Cenpa T C 5: 30,830,699 (GRCm39) probably benign Het
Cfap61 T C 2: 145,781,800 (GRCm39) V11A probably benign Het
Chfr T A 5: 110,308,109 (GRCm39) probably null Het
Col14a1 A T 15: 55,271,137 (GRCm39) Y630F unknown Het
Cst5 A G 2: 149,251,902 (GRCm39) N126D possibly damaging Het
Cubn T C 2: 13,354,688 (GRCm39) T1903A probably benign Het
Dnajb8 C T 6: 88,199,940 (GRCm39) R159C possibly damaging Het
Gon4l A G 3: 88,802,449 (GRCm39) E1020G probably damaging Het
Gp1ba A G 11: 70,530,683 (GRCm39) N150D unknown Het
Gstm2 T C 3: 107,891,314 (GRCm39) I169V probably benign Het
Ighv1-75 A T 12: 115,797,859 (GRCm39) V21D probably benign Het
Il7 T C 3: 7,642,308 (GRCm39) M51V possibly damaging Het
Insm2 A T 12: 55,646,763 (GRCm39) D169V probably damaging Het
Jmjd1c A G 10: 67,080,628 (GRCm39) D373G noncoding transcript Het
Kif16b T C 2: 142,676,008 (GRCm39) N431D probably benign Het
Kmt2a A C 9: 44,719,326 (GRCm39) I3925S unknown Het
Lgi4 G A 7: 30,763,017 (GRCm39) C164Y probably damaging Het
Lrfn5 A T 12: 61,890,192 (GRCm39) I494F possibly damaging Het
Map9 T C 3: 82,266,370 (GRCm39) I5T probably benign Het
Ncf2 T C 1: 152,706,144 (GRCm39) V252A possibly damaging Het
Nlrp4g A T 9: 124,353,374 (GRCm38) I573F noncoding transcript Het
Nrn1 G A 13: 36,918,258 (GRCm39) L3F probably damaging Het
Or1ab2 A G 8: 72,864,223 (GRCm39) D271G noncoding transcript Het
Or2d2 T A 7: 106,728,079 (GRCm39) I174F probably damaging Het
Or5h24 A T 16: 58,919,117 (GRCm39) D79E unknown Het
Or6c8 A G 10: 128,915,304 (GRCm39) F176S possibly damaging Het
Otop1 C A 5: 38,457,846 (GRCm39) T535K possibly damaging Het
Pacs2 A G 12: 113,023,380 (GRCm39) T333A probably damaging Het
Pax3 T C 1: 78,098,327 (GRCm39) Y354C probably damaging Het
Phlpp1 T C 1: 106,320,348 (GRCm39) S1448P probably damaging Het
Pias4 C A 10: 81,003,565 (GRCm39) probably benign Het
Ppp1r12b T C 1: 134,830,200 (GRCm39) N113S probably benign Het
Ptpn12 G T 5: 21,203,656 (GRCm39) P374Q probably damaging Het
Reg4 A T 3: 98,132,011 (GRCm39) probably benign Het
Sh3bp5 T C 14: 31,099,473 (GRCm39) D256G probably damaging Het
Slc25a32 C G 15: 38,976,015 (GRCm39) probably benign Het
Tnip2 C T 5: 34,671,003 (GRCm39) R80Q possibly damaging Het
Uroc1 A G 6: 90,321,049 (GRCm39) probably null Het
Washc2 A C 6: 116,218,457 (GRCm39) K634T probably damaging Het
Xpot A T 10: 121,443,513 (GRCm39) Y405N probably damaging Het
Yes1 T C 5: 32,816,417 (GRCm39) Y365H probably benign Het
Zfp607a A T 7: 27,577,536 (GRCm39) E202V probably damaging Het
Zfp932 T C 5: 110,144,480 (GRCm39) probably benign Het
Zfp947 A C 17: 22,364,363 (GRCm39) M437R probably benign Het
Zscan10 A G 17: 23,828,366 (GRCm39) T303A probably benign Het
Other mutations in Card11
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140,897,997 (GRCm38) intron probably benign
IGL00961:Card11 APN 5 140,885,464 (GRCm39) missense probably damaging 0.97
IGL01645:Card11 APN 5 140,863,778 (GRCm39) missense probably benign 0.00
IGL01731:Card11 APN 5 140,868,057 (GRCm39) missense possibly damaging 0.89
IGL01782:Card11 APN 5 140,913,481 (GRCm39) start codon destroyed probably null 0.02
IGL01935:Card11 APN 5 140,869,301 (GRCm39) missense possibly damaging 0.62
IGL01991:Card11 APN 5 140,899,133 (GRCm39) missense possibly damaging 0.63
IGL02447:Card11 APN 5 140,892,679 (GRCm39) missense possibly damaging 0.93
IGL02583:Card11 APN 5 140,863,881 (GRCm39) missense probably benign 0.10
IGL03255:Card11 APN 5 140,884,086 (GRCm39) missense possibly damaging 0.73
Ace UTSW 5 140,888,632 (GRCm39) missense possibly damaging 0.70
Caravaggio UTSW 5 140,899,064 (GRCm39) missense probably damaging 1.00
Dealer UTSW 5 140,871,632 (GRCm39) missense probably damaging 1.00
Dogs UTSW 5 140,867,755 (GRCm39) critical splice donor site probably null
Face UTSW 5 140,886,732 (GRCm39) missense probably damaging 1.00
hubei UTSW 5 140,892,522 (GRCm39) missense probably damaging 0.96
king UTSW 5 140,876,835 (GRCm39) splice site probably benign
may UTSW 5 140,862,250 (GRCm39) nonsense probably null
Poker UTSW 5 140,863,837 (GRCm39) missense probably benign
Sharp UTSW 5 140,862,180 (GRCm39) missense possibly damaging 0.93
Tumnus UTSW 5 140,871,700 (GRCm39) missense possibly damaging 0.75
unmodulated2 UTSW 5 140,869,537 (GRCm39) splice site probably null
PIT4243001:Card11 UTSW 5 140,894,359 (GRCm39) missense possibly damaging 0.95
PIT4486001:Card11 UTSW 5 140,862,163 (GRCm39) missense probably damaging 1.00
PIT4531001:Card11 UTSW 5 140,892,415 (GRCm39) missense probably damaging 0.99
R0046:Card11 UTSW 5 140,894,279 (GRCm39) missense possibly damaging 0.92
R0285:Card11 UTSW 5 140,872,856 (GRCm39) missense probably damaging 1.00
R0452:Card11 UTSW 5 140,866,125 (GRCm39) missense probably benign 0.01
R1486:Card11 UTSW 5 140,862,274 (GRCm39) missense probably benign
R1710:Card11 UTSW 5 140,888,660 (GRCm39) nonsense probably null
R1733:Card11 UTSW 5 140,892,388 (GRCm39) missense possibly damaging 0.88
R1817:Card11 UTSW 5 140,871,315 (GRCm39) missense probably benign 0.00
R1818:Card11 UTSW 5 140,871,315 (GRCm39) missense probably benign 0.00
R2027:Card11 UTSW 5 140,892,522 (GRCm39) missense probably damaging 0.96
R2436:Card11 UTSW 5 140,868,117 (GRCm39) missense possibly damaging 0.89
R2904:Card11 UTSW 5 140,874,888 (GRCm39) missense probably benign 0.09
R3706:Card11 UTSW 5 140,872,890 (GRCm39) missense probably damaging 0.99
R3708:Card11 UTSW 5 140,872,890 (GRCm39) missense probably damaging 0.99
R4778:Card11 UTSW 5 140,869,537 (GRCm39) splice site probably null
R4877:Card11 UTSW 5 140,871,632 (GRCm39) missense probably damaging 1.00
R4889:Card11 UTSW 5 140,871,700 (GRCm39) missense possibly damaging 0.75
R4910:Card11 UTSW 5 140,860,169 (GRCm39) missense probably damaging 1.00
R5011:Card11 UTSW 5 140,862,275 (GRCm39) missense possibly damaging 0.93
R5257:Card11 UTSW 5 140,862,180 (GRCm39) missense possibly damaging 0.93
R5258:Card11 UTSW 5 140,862,180 (GRCm39) missense possibly damaging 0.93
R5682:Card11 UTSW 5 140,888,666 (GRCm39) nonsense probably null
R5754:Card11 UTSW 5 140,885,524 (GRCm39) missense probably damaging 0.99
R5873:Card11 UTSW 5 140,894,393 (GRCm39) missense probably damaging 1.00
R6184:Card11 UTSW 5 140,884,033 (GRCm39) missense probably damaging 1.00
R6792:Card11 UTSW 5 140,899,064 (GRCm39) missense probably damaging 1.00
R6825:Card11 UTSW 5 140,863,837 (GRCm39) missense probably benign
R7008:Card11 UTSW 5 140,859,148 (GRCm39) missense probably damaging 1.00
R7291:Card11 UTSW 5 140,886,825 (GRCm39) missense probably damaging 1.00
R7376:Card11 UTSW 5 140,883,993 (GRCm39) missense probably benign 0.01
R7526:Card11 UTSW 5 140,899,184 (GRCm39) splice site probably null
R7683:Card11 UTSW 5 140,881,781 (GRCm39) missense probably benign
R7730:Card11 UTSW 5 140,871,751 (GRCm39) missense probably damaging 0.96
R7813:Card11 UTSW 5 140,885,419 (GRCm39) missense probably damaging 1.00
R7831:Card11 UTSW 5 140,859,167 (GRCm39) missense possibly damaging 0.61
R7911:Card11 UTSW 5 140,867,755 (GRCm39) critical splice donor site probably null
R8154:Card11 UTSW 5 140,886,732 (GRCm39) missense probably damaging 1.00
R8272:Card11 UTSW 5 140,875,794 (GRCm39) missense probably damaging 1.00
R8714:Card11 UTSW 5 140,899,147 (GRCm39) missense possibly damaging 0.67
R8715:Card11 UTSW 5 140,871,315 (GRCm39) missense probably benign 0.00
R9065:Card11 UTSW 5 140,894,297 (GRCm39) missense probably damaging 1.00
R9211:Card11 UTSW 5 140,869,375 (GRCm39) missense probably benign 0.16
R9215:Card11 UTSW 5 140,866,154 (GRCm39) missense possibly damaging 0.64
R9269:Card11 UTSW 5 140,892,516 (GRCm39) missense probably damaging 0.99
R9385:Card11 UTSW 5 140,871,276 (GRCm39) missense probably benign 0.44
R9421:Card11 UTSW 5 140,869,462 (GRCm39) missense probably damaging 0.97
R9424:Card11 UTSW 5 140,894,395 (GRCm39) missense probably damaging 1.00
R9444:Card11 UTSW 5 140,894,393 (GRCm39) missense probably damaging 1.00
V7732:Card11 UTSW 5 140,862,250 (GRCm39) nonsense probably null
X0067:Card11 UTSW 5 140,871,347 (GRCm39) missense possibly damaging 0.60
Z1177:Card11 UTSW 5 140,883,996 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TAGCCCTCCCCTATACAAGG -3'
(R):5'- CATTGCATGTGTCAGGAAATGG -3'

Sequencing Primer
(F):5'- CTATACAAGGGTGGTGCGTCTCAC -3'
(R):5'- CTCACCTAGTAAGATGGACTGGCTG -3'
Posted On 2020-07-13