Incidental Mutation 'R8224:Pias4'
ID636897
Institutional Source Beutler Lab
Gene Symbol Pias4
Ensembl Gene ENSMUSG00000004934
Gene Nameprotein inhibitor of activated STAT 4
SynonymsPIASy
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R8224 (G1)
Quality Score174.009
Status Not validated
Chromosome10
Chromosomal Location81153266-81167923 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to A at 81167731 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005064]
Predicted Effect probably benign
Transcript: ENSMUST00000005064
SMART Domains Protein: ENSMUSP00000005064
Gene: ENSMUSG00000004934

DomainStartEndE-ValueType
SAP 12 46 4.44e-7 SMART
Pfam:PINIT 123 270 9.6e-35 PFAM
Pfam:zf-MIZ 315 364 2.4e-24 PFAM
low complexity region 429 454 N/A INTRINSIC
low complexity region 469 489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146764
SMART Domains Protein: ENSMUSP00000122183
Gene: ENSMUSG00000004934

DomainStartEndE-ValueType
SAP 12 46 4.44e-7 SMART
Pfam:PINIT 119 270 1.8e-43 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants display mild postnatal lethality or a normal phenotype depending on strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,218,253 E45V probably damaging Het
Adamts9 A T 6: 92,796,370 V1754D probably damaging Het
Ankrd26 G A 6: 118,525,755 T818M probably damaging Het
Card11 T C 5: 140,902,877 E242G possibly damaging Het
Cdh7 G T 1: 109,994,203 L8F probably benign Het
Cfap61 T C 2: 145,939,880 V11A probably benign Het
Chfr T A 5: 110,160,243 probably null Het
Col14a1 A T 15: 55,407,741 Y630F unknown Het
Cst10 A G 2: 149,409,982 N126D possibly damaging Het
Cubn T C 2: 13,349,877 T1903A probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Fam21 A C 6: 116,241,496 K634T probably damaging Het
Gon4l A G 3: 88,895,142 E1020G probably damaging Het
Gp1ba A G 11: 70,639,857 N150D unknown Het
Gstm2 T C 3: 107,983,998 I169V probably benign Het
Ighv1-75 A T 12: 115,834,239 V21D probably benign Het
Il7 T C 3: 7,577,248 M51V possibly damaging Het
Insm2 A T 12: 55,599,978 D169V probably damaging Het
Jmjd1c A G 10: 67,244,849 D373G noncoding transcript Het
Kif16b T C 2: 142,834,088 N431D probably benign Het
Kmt2a A C 9: 44,808,029 I3925S unknown Het
Lgi4 G A 7: 31,063,592 C164Y probably damaging Het
Lrfn5 A T 12: 61,843,406 I494F possibly damaging Het
Map9 T C 3: 82,359,063 I5T probably benign Het
Ncf2 T C 1: 152,830,393 V252A possibly damaging Het
Nlrp4g A T 9: 124,353,374 I573F noncoding transcript Het
Nrn1 G A 13: 36,734,284 L3F probably damaging Het
Olfr192 A T 16: 59,098,754 D79E unknown Het
Olfr374 A G 8: 72,110,379 D271G noncoding transcript Het
Olfr715 T A 7: 107,128,872 I174F probably damaging Het
Olfr767 A G 10: 129,079,435 F176S possibly damaging Het
Otop1 C A 5: 38,300,503 T535K possibly damaging Het
Pacs2 A G 12: 113,059,760 T333A probably damaging Het
Pax3 T C 1: 78,121,690 Y354C probably damaging Het
Phlpp1 T C 1: 106,392,618 S1448P probably damaging Het
Ppp1r12b T C 1: 134,902,462 N113S probably benign Het
Ptpn12 G T 5: 20,998,658 P374Q probably damaging Het
Reg4 A T 3: 98,224,695 probably benign Het
Sh3bp5 T C 14: 31,377,516 D256G probably damaging Het
Tnip2 C T 5: 34,513,659 R80Q possibly damaging Het
Xpot A T 10: 121,607,608 Y405N probably damaging Het
Yes1 T C 5: 32,659,073 Y365H probably benign Het
Zfp607a A T 7: 27,878,111 E202V probably damaging Het
Zfp932 T C 5: 109,996,614 probably benign Het
Zfp947 A C 17: 22,145,382 M437R probably benign Het
Zscan10 A G 17: 23,609,392 T303A probably benign Het
Other mutations in Pias4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Pias4 APN 10 81155658 missense probably benign 0.07
IGL01790:Pias4 APN 10 81157498 missense probably damaging 0.98
IGL02553:Pias4 APN 10 81163787 missense probably damaging 1.00
IGL02670:Pias4 APN 10 81164070 missense probably damaging 0.99
petrified_forest UTSW 10 81155855 missense probably damaging 1.00
R0083:Pias4 UTSW 10 81164166 missense probably damaging 1.00
R0122:Pias4 UTSW 10 81157087 missense probably damaging 0.96
R0711:Pias4 UTSW 10 81157530 unclassified probably benign
R1399:Pias4 UTSW 10 81155675 missense probably damaging 1.00
R1726:Pias4 UTSW 10 81155855 missense probably damaging 1.00
R1907:Pias4 UTSW 10 81154363 missense possibly damaging 0.46
R3730:Pias4 UTSW 10 81164054 missense probably damaging 0.98
R4764:Pias4 UTSW 10 81164034 missense possibly damaging 0.88
R4790:Pias4 UTSW 10 81157492 missense probably damaging 0.98
R4808:Pias4 UTSW 10 81155840 unclassified probably null
R6351:Pias4 UTSW 10 81157264 missense probably damaging 1.00
R6786:Pias4 UTSW 10 81157246 missense probably damaging 1.00
R7113:Pias4 UTSW 10 81154453 missense possibly damaging 0.94
R7260:Pias4 UTSW 10 81157468 missense possibly damaging 0.95
R7487:Pias4 UTSW 10 81163972 missense probably benign
R7609:Pias4 UTSW 10 81158026 splice site probably null
R8387:Pias4 UTSW 10 81154508 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGCTAGGGTCAGTAGAGAAG -3'
(R):5'- TGATTGGTCAGATCCTCGGG -3'

Sequencing Primer
(F):5'- CAGTAGACGGCGGGGACAC -3'
(R):5'- GCGGGGTTCCTGTAGGC -3'
Posted On2020-07-13