Mutagenetix > Incidental Mutations

Incidental Mutation 'R0718:Hgf'

63690

Institutional Source

Beutler Lab

Gene Symbol

Hgf

Ensembl Gene

ENSMUSG00000028864

Gene Name

hepatocyte growth factor

Synonyms

HGF/SF, NK1, C230052L06Rik, scatter factor, NK2, SF/HGF

MMRRC Submission

038900-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0718 (G1)

Quality Score

187

Status

Validated

Chromosome

Chromosomal Location

16553495-16620152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 16593859 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 295 (N295S)

Ref Sequence

ENSEMBL: ENSMUSP00000143424 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030683] [ENSMUST00000196645] [ENSMUST00000199581]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030683
AA Change: N295S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030683
Gene: ENSMUSG00000028864
AA Change: N295S

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	209	3.03e-46	SMART
KR	210	291	9.04e-45	SMART
KR	304	386	7.35e-45	SMART
KR	390	472	1.02e-38	SMART
Tryp_SPc	495	719	5.6e-55	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000196645
AA Change: N290S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142517
Gene: ENSMUSG00000028864
AA Change: N290S

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	204	3.76e-42	SMART
KR	205	286	9.04e-45	SMART
KR	299	381	7.35e-45	SMART
KR	385	467	1.02e-38	SMART
Tryp_SPc	490	714	5.6e-55	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000199581
AA Change: N295S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143424
Gene: ENSMUSG00000028864
AA Change: N295S

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	209	3.03e-46	SMART
KR	210	291	9.04e-45	SMART
KR	304	386	7.35e-45	SMART
KR	390	472	1.02e-38	SMART
Tryp_SPc	495	719	5.6e-55	SMART

Meta Mutation Damage Score

0.0624

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced embryonic livers, impaired migration of dermomyotome precursors affecting skeletal muscle formation, defective navigation of hypoglossal motor axons, abnormal placentas, and prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl4	A	T	3: 95,679,608	Y811N	possibly damaging	Het
Adrm1	T	C	2: 180,175,147		probably benign	Het
Alms1	T	A	6: 85,621,821	S1210T	probably benign	Het
Ampd3	C	T	7: 110,777,808	P11L	probably damaging	Het
Arhgap5	A	G	12: 52,516,507	E87G	possibly damaging	Het
Armc5	C	T	7: 128,240,070		probably benign	Het
Asic2	C	G	11: 80,971,456		probably benign	Het
Asph	A	G	4: 9,514,683		probably benign	Het
Bicd2	T	A	13: 49,377,875		probably null	Het
Brip1	A	G	11: 86,143,305	L530P	possibly damaging	Het
Bsn	G	T	9: 108,111,360		probably benign	Het
Btnl4	T	A	17: 34,469,634	H390L	probably benign	Het
Ccdc70	A	C	8: 21,973,308	K38T	probably damaging	Het
Ccni	G	A	5: 93,202,316	P35S	probably benign	Het
Cdh17	A	G	4: 11,810,451	D714G	possibly damaging	Het
Cenpf	A	G	1: 189,653,984	L2033P	probably damaging	Het
Cfap69	A	T	5: 5,621,924	M328K	probably damaging	Het
Cmah	T	G	13: 24,417,210		probably null	Het
Cog6	T	C	3: 53,010,629	T163A	probably benign	Het
Cyp2j8	G	A	4: 96,501,196	S130F	probably benign	Het
Dgki	A	G	6: 37,012,896	V636A	probably damaging	Het
Dmkn	T	A	7: 30,764,786		probably benign	Het
Dnah6	A	G	6: 73,035,293	I3679T	possibly damaging	Het
Dsp	A	T	13: 38,196,764	Y2495F	possibly damaging	Het
Exosc4	C	T	15: 76,329,489	A171V	probably benign	Het
Fbxw24	A	G	9: 109,623,509		probably benign	Het
Flvcr1	A	T	1: 191,025,582	L171Q	probably damaging	Het
Fsd1	G	T	17: 55,996,445		probably null	Het
Gm7732	A	G	17: 21,129,844		noncoding transcript	Het
H2-K2	A	C	17: 33,975,623		noncoding transcript	Het
Ift88	T	A	14: 57,517,413	D811E	probably benign	Het
Igsf9b	T	A	9: 27,323,361		probably null	Het
Immt	T	A	6: 71,863,172	V311E	probably damaging	Het
Ipo11	T	A	13: 106,919,611	N51I	possibly damaging	Het
Isy1	T	C	6: 87,819,176	K260E	probably damaging	Het
Jchain	T	G	5: 88,526,202	I28L	probably benign	Het
Jmjd1c	T	A	10: 67,218,946		probably null	Het
Kif13b	T	C	14: 64,751,662		probably benign	Het
Klhdc7b	T	C	15: 89,388,169	Y427H	possibly damaging	Het
Klhl8	T	C	5: 103,876,293		probably benign	Het
Lrp2	C	T	2: 69,510,948	D963N	probably damaging	Het
Ltbp3	G	T	19: 5,746,748		probably benign	Het
Ltf	C	A	9: 111,040,379	Q41K	probably benign	Het
Med4	T	A	14: 73,516,657	I148N	probably damaging	Het
Mlh3	T	G	12: 85,247,697	S1242R	possibly damaging	Het
Mllt6	T	C	11: 97,676,359		probably benign	Het
Mpdz	A	G	4: 81,292,473	I1712T	possibly damaging	Het
Mrgprb4	T	A	7: 48,198,553	H209L	probably benign	Het
Nkapl	A	T	13: 21,468,440	M1K	probably null	Het
Nmur2	T	A	11: 56,029,498		probably benign	Het
Nsun2	T	A	13: 69,543,697		probably benign	Het
Olfr1082	G	A	2: 86,594,081	T249I	probably benign	Het
Olfr1130	A	G	2: 87,607,927	I180V	probably benign	Het
Ovgp1	T	C	3: 105,974,830		probably benign	Het
Pcdh8	A	G	14: 79,770,691	V144A	possibly damaging	Het
Pcnx3	G	A	19: 5,677,728		probably benign	Het
Pla2r1	C	A	2: 60,479,530	V570L	possibly damaging	Het
Plxnd1	C	A	6: 115,966,638	E1202D	possibly damaging	Het
Ppp1r37	T	C	7: 19,532,254	E529G	probably benign	Het
Prdm15	A	G	16: 97,812,633	F496L	possibly damaging	Het
Prlhr	A	T	19: 60,468,005	V41D	probably benign	Het
Prlhr	G	T	19: 60,468,059	S23*	probably null	Het
Prpf4	C	T	4: 62,414,540		probably benign	Het
Psg26	C	T	7: 18,475,235	R416H	probably benign	Het
Psg26	T	C	7: 18,478,287	H381R	probably benign	Het
Ralgds	T	G	2: 28,549,116	M717R	probably benign	Het
Rbms1	T	C	2: 60,842,412	N44D	probably damaging	Het
Rpa1	T	C	11: 75,318,401		probably benign	Het
Rprd2	T	C	3: 95,766,387	N568S	probably benign	Het
Rptor	A	G	11: 119,872,376	M929V	probably benign	Het
Rspo1	T	A	4: 125,007,149	C97S	possibly damaging	Het
Scin	C	T	12: 40,079,607	G396S	probably damaging	Het
Scn9a	T	C	2: 66,547,112	N409D	probably damaging	Het
Sf3b1	A	G	1: 55,019,385	I15T	probably damaging	Het
Sh3bp2	T	C	5: 34,555,495	V149A	probably damaging	Het
Slc39a12	T	A	2: 14,407,426		probably benign	Het
Sp9	G	T	2: 73,273,827	A242S	possibly damaging	Het
Srr	A	G	11: 74,911,065	V126A	possibly damaging	Het
Tatdn3	G	T	1: 191,052,849		probably benign	Het
Tex14	G	A	11: 87,499,613	V379I	probably benign	Het
Tmed6	T	C	8: 107,061,724	N197S	probably damaging	Het
Ttbk2	G	A	2: 120,748,575	L689F	probably benign	Het
Ttbk2	A	T	2: 120,745,160	I1043N	probably benign	Het
Ttn	A	G	2: 76,810,696	S5283P	probably damaging	Het
Ube3b	C	A	5: 114,402,555	S441*	probably null	Het
Ush2a	G	A	1: 188,797,830	C3272Y	probably damaging	Het
Vac14	T	A	8: 110,632,477	I95K	probably damaging	Het
Vangl2	G	A	1: 172,006,217	A433V	probably damaging	Het
Vwa5b1	A	T	4: 138,608,824	V153D	probably damaging	Het
Zfhx3	T	A	8: 108,955,650	D3240E	unknown	Het
Zfp945	A	G	17: 22,851,030	C632R	probably damaging	Het
Zfyve26	G	A	12: 79,265,802		probably benign	Het
Zyg11b	A	T	4: 108,242,076	I606N	possibly damaging	Het

Other mutations in Hgf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Hgf	APN	5	16611882	missense	possibly damaging	0.70
IGL00427:Hgf	APN	5	16578486	missense	probably benign	0.09
IGL00788:Hgf	APN	5	16598230	missense	probably damaging	0.99
IGL01290:Hgf	APN	5	16604846	missense	probably damaging	1.00
IGL01333:Hgf	APN	5	16576941	nonsense	probably null
IGL01568:Hgf	APN	5	16564814	missense	probably damaging	1.00
IGL02314:Hgf	APN	5	16572602	missense	probably damaging	0.99
IGL02328:Hgf	APN	5	16598221	missense	probably damaging	1.00
IGL02368:Hgf	APN	5	16564794	missense	possibly damaging	0.95
IGL02486:Hgf	APN	5	16602289	missense	probably damaging	1.00
IGL02654:Hgf	APN	5	16561051	missense	probably benign
Foiegras	UTSW	5	16615802	missense	probably benign	0.01
PIT4378001:Hgf	UTSW	5	16611862	missense	probably damaging	1.00
R0708:Hgf	UTSW	5	16566763	nonsense	probably null
R0710:Hgf	UTSW	5	16566763	nonsense	probably null
R0967:Hgf	UTSW	5	16593841	splice site	probably benign
R1181:Hgf	UTSW	5	16618925	missense	probably damaging	1.00
R1589:Hgf	UTSW	5	16613785	missense	probably damaging	1.00
R1705:Hgf	UTSW	5	16615802	missense	probably benign	0.01
R1983:Hgf	UTSW	5	16561012	missense	possibly damaging	0.53
R2021:Hgf	UTSW	5	16576921	missense	probably benign
R2441:Hgf	UTSW	5	16604790	missense	probably damaging	0.99
R4083:Hgf	UTSW	5	16615858	nonsense	probably null
R4084:Hgf	UTSW	5	16615858	nonsense	probably null
R4211:Hgf	UTSW	5	16614993	missense	probably damaging	0.99
R4388:Hgf	UTSW	5	16614943	missense	probably benign	0.12
R4394:Hgf	UTSW	5	16618951	nonsense	probably null
R4575:Hgf	UTSW	5	16572601	missense	probably benign
R5044:Hgf	UTSW	5	16614894	missense	probably benign	0.00
R5319:Hgf	UTSW	5	16566862	critical splice donor site	probably null
R5585:Hgf	UTSW	5	16564801	missense	possibly damaging	0.93
R5700:Hgf	UTSW	5	16610124	missense	probably damaging	1.00
R5814:Hgf	UTSW	5	16602307	missense	probably benign	0.19
R6125:Hgf	UTSW	5	16598161	missense	probably damaging	1.00
R6749:Hgf	UTSW	5	16613642	intron	probably null
R6891:Hgf	UTSW	5	16604922	critical splice donor site	probably null
R6962:Hgf	UTSW	5	16615754	missense	probably benign	0.32
R7251:Hgf	UTSW	5	16593944	missense	possibly damaging	0.95
R7296:Hgf	UTSW	5	16564843	missense	probably benign	0.39
R7463:Hgf	UTSW	5	16578450	missense	probably benign	0.00
R7470:Hgf	UTSW	5	16618856	missense	probably benign	0.02
R7630:Hgf	UTSW	5	16598250	missense	probably benign	0.01
R7807:Hgf	UTSW	5	16577011	missense	probably damaging	0.99
X0024:Hgf	UTSW	5	16604828	missense	probably damaging	1.00
Z1088:Hgf	UTSW	5	16618919	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATACATGCCATCTGCACACATGC -3'
(R):5'- AGCGAAAGCAGTCTTCCTCATTTCC -3'

Sequencing Primer
(F):5'- GAGGAAACTTGTCTTTAGGAATGAC -3'
(R):5'- TTGCAGCATTGCCTGAAAC -3'

Posted On

2013-07-30