Incidental Mutation 'R8225:Exosc10'
ID636919
Institutional Source Beutler Lab
Gene Symbol Exosc10
Ensembl Gene ENSMUSG00000017264
Gene Nameexosome component 10
SynonymsPmscl2, PM-Scl, p3, p2, PM/Scl-100, RRP6, p4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8225 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location148558429-148582401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 148565204 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 364 (V364I)
Ref Sequence ENSEMBL: ENSMUSP00000017408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017408] [ENSMUST00000076022] [ENSMUST00000097781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017408
AA Change: V364I

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000017408
Gene: ENSMUSG00000017264
AA Change: V364I

DomainStartEndE-ValueType
Pfam:PMC2NT 44 133 2.7e-26 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 745 760 N/A INTRINSIC
coiled coil region 769 800 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000076022
AA Change: V364I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075401
Gene: ENSMUSG00000017264
AA Change: V364I

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 5.1e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 720 735 N/A INTRINSIC
coiled coil region 744 775 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097781
AA Change: V364I

PolyPhen 2 Score 0.582 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095388
Gene: ENSMUSG00000017264
AA Change: V364I

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 1.4e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150723
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,826,516 N82S probably benign Het
Ago3 A T 4: 126,353,739 L595Q probably damaging Het
Bpifc T C 10: 86,000,567 T25A probably benign Het
Bsn T A 9: 108,107,106 T478S Het
Cacna1d A G 14: 30,123,033 V720A probably benign Het
Cd109 G T 9: 78,661,690 K350N probably damaging Het
Cdk6 C A 5: 3,390,790 P115T probably benign Het
Clock T C 5: 76,241,912 N363S probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dock10 T A 1: 80,503,730 K517* probably null Het
Dynlt1a G T 17: 6,311,353 Q71K probably damaging Het
E330021D16Rik A T 6: 136,401,112 L240Q probably damaging Het
Epb41l3 C T 17: 69,274,801 T591I possibly damaging Het
Fabp3-ps1 A G 10: 86,732,234 I52T noncoding transcript Het
Fndc3a T C 14: 72,557,677 Q766R probably benign Het
Gm10608 CACACACACAGA CA 9: 119,160,708 probably null Het
Gm10645 C T 8: 83,165,838 R80H unknown Het
Gm7849 T C 8: 21,456,402 D39G possibly damaging Het
Gpr146 A T 5: 139,392,616 M58L probably benign Het
Gzf1 T A 2: 148,690,844 F639L probably benign Het
Kars T C 8: 112,003,338 I136V probably benign Het
Kcnj3 G A 2: 55,437,714 V172M probably damaging Het
Kcnk10 A G 12: 98,440,590 probably null Het
Nagpa C A 16: 5,198,860 D334Y probably damaging Het
Nsun2 T C 13: 69,612,374 I57T possibly damaging Het
Olfr1461 A T 19: 13,165,143 N43I probably damaging Het
Pax8 A T 2: 24,422,971 L432Q probably damaging Het
Plxna4 A G 6: 32,162,103 L1710P probably damaging Het
Prdm16 A G 4: 154,355,245 probably null Het
Qrich2 A G 11: 116,454,068 L1721P probably damaging Het
Sbsn TCCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATG TCCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATG 7: 30,751,994 probably benign Het
Sbsn T C 7: 30,752,444 F295L probably benign Het
Slc4a7 C T 14: 14,738,224 R153* probably null Het
Sult6b2 A T 6: 142,804,329 M21K probably benign Het
Swt1 A C 1: 151,422,108 S23A possibly damaging Het
Synm A C 7: 67,759,049 S194A probably benign Het
Sytl2 G A 7: 90,375,517 A238T probably benign Het
Tax1bp1 G A 6: 52,744,355 probably null Het
Tfr2 G A 5: 137,571,463 A74T possibly damaging Het
Tns1 G A 1: 73,985,887 T389I probably damaging Het
Trpm2 C T 10: 77,947,973 R222Q probably damaging Het
Trpm4 A G 7: 45,305,334 C1094R probably benign Het
Uty T C Y: 1,158,634 S471G probably benign Het
Vipr1 A T 9: 121,642,849 M1L possibly damaging Het
Vps13b A G 15: 35,794,382 R2313G probably damaging Het
Xrn1 T A 9: 96,035,667 C1301S probably benign Het
Ythdc1 A T 5: 86,816,937 S164C possibly damaging Het
Ythdc1 G T 5: 86,816,938 S164I possibly damaging Het
Zbtb9 T A 17: 26,974,785 I388N probably damaging Het
Zfp521 T C 18: 13,845,302 I685V probably benign Het
Other mutations in Exosc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Exosc10 APN 4 148565271 missense probably damaging 1.00
IGL01591:Exosc10 APN 4 148562887 unclassified probably benign
IGL01990:Exosc10 APN 4 148566410 missense possibly damaging 0.83
IGL02137:Exosc10 APN 4 148561133 missense probably damaging 0.97
IGL02186:Exosc10 APN 4 148565298 missense probably damaging 0.96
IGL02412:Exosc10 APN 4 148568392 missense probably benign 0.15
IGL02880:Exosc10 APN 4 148576183 missense probably damaging 1.00
R0172:Exosc10 UTSW 4 148565357 missense probably benign 0.02
R0267:Exosc10 UTSW 4 148562756 missense probably damaging 1.00
R0592:Exosc10 UTSW 4 148581113 missense probably benign
R1122:Exosc10 UTSW 4 148566364 missense possibly damaging 0.86
R1218:Exosc10 UTSW 4 148570401 missense probably damaging 1.00
R1498:Exosc10 UTSW 4 148581786 missense possibly damaging 0.66
R1591:Exosc10 UTSW 4 148568383 missense probably benign 0.04
R1719:Exosc10 UTSW 4 148568503 missense probably damaging 1.00
R1760:Exosc10 UTSW 4 148578469 nonsense probably null
R3727:Exosc10 UTSW 4 148565277 missense probably damaging 1.00
R3842:Exosc10 UTSW 4 148563865 nonsense probably null
R3876:Exosc10 UTSW 4 148572919 missense probably benign 0.00
R4476:Exosc10 UTSW 4 148565324 missense probably damaging 0.98
R4750:Exosc10 UTSW 4 148562394 missense possibly damaging 0.69
R5306:Exosc10 UTSW 4 148562392 missense probably benign 0.13
R5438:Exosc10 UTSW 4 148566342 nonsense probably null
R5835:Exosc10 UTSW 4 148565387 missense probably damaging 1.00
R5925:Exosc10 UTSW 4 148573362 missense probably benign 0.01
R6116:Exosc10 UTSW 4 148573353 missense probably benign 0.08
R6217:Exosc10 UTSW 4 148582311 splice site probably null
R6365:Exosc10 UTSW 4 148561105 missense probably benign 0.13
R6495:Exosc10 UTSW 4 148562872 missense probably benign 0.45
R6498:Exosc10 UTSW 4 148573338 missense probably benign
R6772:Exosc10 UTSW 4 148581134 missense probably damaging 1.00
R7297:Exosc10 UTSW 4 148580377 missense probably damaging 1.00
R7523:Exosc10 UTSW 4 148563842 critical splice acceptor site probably null
R7698:Exosc10 UTSW 4 148558498 missense probably benign
R7967:Exosc10 UTSW 4 148564664 missense probably damaging 1.00
R8477:Exosc10 UTSW 4 148565390 missense possibly damaging 0.71
R8510:Exosc10 UTSW 4 148564189 missense probably damaging 1.00
Z1177:Exosc10 UTSW 4 148565386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACAGTTACAGACAGGC -3'
(R):5'- ACTGAACTGACCGTATCCTCC -3'

Sequencing Primer
(F):5'- CAGTTACAGACAGGCTCAGAGC -3'
(R):5'- CAGTCTGCCAGCTGATATTGC -3'
Posted On2020-07-13