Incidental Mutation 'R8225:Clock'
ID636922
Institutional Source Beutler Lab
Gene Symbol Clock
Ensembl Gene ENSMUSG00000029238
Gene Namecircadian locomotor output cycles kaput
Synonyms5330400M04Rik, bHLHe8, KAT13D
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R8225 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location76209868-76304792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76241912 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 363 (N363S)
Ref Sequence ENSEMBL: ENSMUSP00000074656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202651]
PDB Structure
Crystal Structure of the Heterodimeric CLOCK:BMAL1 Transcriptional Activator Complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000075159
AA Change: N363S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238
AA Change: N363S

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202122
AA Change: N363S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238
AA Change: N363S

DomainStartEndE-ValueType
TFS2N 34 106 4.1e-3 SMART
HLH 40 90 3.4e-14 SMART
PAS 109 175 9.6e-9 SMART
PAS 264 330 1.8e-6 SMART
PAC 336 379 3.9e-9 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 737 795 N/A INTRINSIC
low complexity region 817 836 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202651
AA Change: N363S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238
AA Change: N363S

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,826,516 N82S probably benign Het
Ago3 A T 4: 126,353,739 L595Q probably damaging Het
Bpifc T C 10: 86,000,567 T25A probably benign Het
Bsn T A 9: 108,107,106 T478S Het
Cacna1d A G 14: 30,123,033 V720A probably benign Het
Cd109 G T 9: 78,661,690 K350N probably damaging Het
Cdk6 C A 5: 3,390,790 P115T probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dock10 T A 1: 80,503,730 K517* probably null Het
Dynlt1a G T 17: 6,311,353 Q71K probably damaging Het
E330021D16Rik A T 6: 136,401,112 L240Q probably damaging Het
Epb41l3 C T 17: 69,274,801 T591I possibly damaging Het
Exosc10 G A 4: 148,565,204 V364I possibly damaging Het
Fabp3-ps1 A G 10: 86,732,234 I52T noncoding transcript Het
Fndc3a T C 14: 72,557,677 Q766R probably benign Het
Gm10608 CACACACACAGA CA 9: 119,160,708 probably null Het
Gm10645 C T 8: 83,165,838 R80H unknown Het
Gm7849 T C 8: 21,456,402 D39G possibly damaging Het
Gpr146 A T 5: 139,392,616 M58L probably benign Het
Gzf1 T A 2: 148,690,844 F639L probably benign Het
Kars T C 8: 112,003,338 I136V probably benign Het
Kcnj3 G A 2: 55,437,714 V172M probably damaging Het
Kcnk10 A G 12: 98,440,590 probably null Het
Nagpa C A 16: 5,198,860 D334Y probably damaging Het
Nsun2 T C 13: 69,612,374 I57T possibly damaging Het
Olfr1461 A T 19: 13,165,143 N43I probably damaging Het
Pax8 A T 2: 24,422,971 L432Q probably damaging Het
Plxna4 A G 6: 32,162,103 L1710P probably damaging Het
Prdm16 A G 4: 154,355,245 probably null Het
Qrich2 A G 11: 116,454,068 L1721P probably damaging Het
Sbsn TCCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATG TCCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATG 7: 30,751,994 probably benign Het
Sbsn T C 7: 30,752,444 F295L probably benign Het
Slc4a7 C T 14: 14,738,224 R153* probably null Het
Sult6b2 A T 6: 142,804,329 M21K probably benign Het
Swt1 A C 1: 151,422,108 S23A possibly damaging Het
Synm A C 7: 67,759,049 S194A probably benign Het
Sytl2 G A 7: 90,375,517 A238T probably benign Het
Tax1bp1 G A 6: 52,744,355 probably null Het
Tfr2 G A 5: 137,571,463 A74T possibly damaging Het
Tns1 G A 1: 73,985,887 T389I probably damaging Het
Trpm2 C T 10: 77,947,973 R222Q probably damaging Het
Trpm4 A G 7: 45,305,334 C1094R probably benign Het
Uty T C Y: 1,158,634 S471G probably benign Het
Vipr1 A T 9: 121,642,849 M1L possibly damaging Het
Vps13b A G 15: 35,794,382 R2313G probably damaging Het
Xrn1 T A 9: 96,035,667 C1301S probably benign Het
Ythdc1 A T 5: 86,816,937 S164C possibly damaging Het
Ythdc1 G T 5: 86,816,938 S164I possibly damaging Het
Zbtb9 T A 17: 26,974,785 I388N probably damaging Het
Zfp521 T C 18: 13,845,302 I685V probably benign Het
Other mutations in Clock
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Clock APN 5 76229464 missense probably benign 0.17
IGL00725:Clock APN 5 76254413 nonsense probably null
IGL01304:Clock APN 5 76266355 critical splice donor site probably null
IGL01369:Clock APN 5 76237086 missense probably benign 0.30
IGL01542:Clock APN 5 76231475 missense possibly damaging 0.82
IGL02541:Clock APN 5 76262672 splice site probably null
IGL02602:Clock APN 5 76254426 missense probably null 1.00
IGL02602:Clock APN 5 76254427 missense probably damaging 1.00
IGL03186:Clock APN 5 76243082 missense probably damaging 0.98
IGL03309:Clock APN 5 76231394 critical splice donor site probably null
R6760_Clock_188 UTSW 5 76226976 missense unknown
uhr UTSW 5 76229554 nonsense probably null
R0304:Clock UTSW 5 76226985 missense unknown
R0593:Clock UTSW 5 76265836 missense probably benign 0.25
R0654:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0684:Clock UTSW 5 76245518 missense probably damaging 0.96
R0707:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0751:Clock UTSW 5 76229361 missense possibly damaging 0.75
R0865:Clock UTSW 5 76266424 splice site probably benign
R0920:Clock UTSW 5 76230320 missense possibly damaging 0.80
R1396:Clock UTSW 5 76266802 missense probably benign 0.00
R1450:Clock UTSW 5 76262731 nonsense probably null
R1487:Clock UTSW 5 76266354 splice site probably null
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1858:Clock UTSW 5 76240909 missense possibly damaging 0.92
R1872:Clock UTSW 5 76248462 missense possibly damaging 0.67
R1905:Clock UTSW 5 76266888 splice site probably benign
R1937:Clock UTSW 5 76229493 missense probably damaging 0.99
R2411:Clock UTSW 5 76231513 missense probably benign 0.08
R2887:Clock UTSW 5 76245273 missense probably damaging 0.99
R3410:Clock UTSW 5 76229554 nonsense probably null
R4514:Clock UTSW 5 76230199 missense probably benign 0.00
R4598:Clock UTSW 5 76235810 missense probably benign 0.00
R4599:Clock UTSW 5 76235810 missense probably benign 0.00
R4795:Clock UTSW 5 76265916 missense probably damaging 1.00
R4796:Clock UTSW 5 76265916 missense probably damaging 1.00
R4973:Clock UTSW 5 76254411 missense possibly damaging 0.62
R5204:Clock UTSW 5 76243170 splice site probably null
R5271:Clock UTSW 5 76241954 missense probably damaging 1.00
R5547:Clock UTSW 5 76230338 missense probably benign 0.02
R5630:Clock UTSW 5 76230338 missense probably benign 0.02
R5631:Clock UTSW 5 76230338 missense probably benign 0.02
R5632:Clock UTSW 5 76230338 missense probably benign 0.02
R5787:Clock UTSW 5 76237051 missense probably damaging 1.00
R6274:Clock UTSW 5 76237153 missense probably benign 0.45
R6578:Clock UTSW 5 76216709 missense unknown
R6622:Clock UTSW 5 76241954 missense probably damaging 1.00
R6760:Clock UTSW 5 76226976 missense unknown
R6793:Clock UTSW 5 76237120 frame shift probably null
R7406:Clock UTSW 5 76266845 start codon destroyed probably null 0.26
R7414:Clock UTSW 5 76262764 missense probably benign 0.00
R7560:Clock UTSW 5 76242891 splice site probably null
R7593:Clock UTSW 5 76236298 missense possibly damaging 0.80
R7640:Clock UTSW 5 76248378 missense possibly damaging 0.71
R7708:Clock UTSW 5 76266409 missense probably benign 0.00
R7713:Clock UTSW 5 76245420 critical splice donor site probably null
R7807:Clock UTSW 5 76243135 missense probably benign 0.01
R8171:Clock UTSW 5 76266414 missense possibly damaging 0.94
R8190:Clock UTSW 5 76227204 missense probably damaging 0.98
R8309:Clock UTSW 5 76254422 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCACAATACTCATGTCAGGCC -3'
(R):5'- TGGCCAGTTAACAGTATGACTTTC -3'

Sequencing Primer
(F):5'- CTTGGGCAAGATCACTATCA -3'
(R):5'- CTGACTATAAAATTGGAATCTGGGAG -3'
Posted On2020-07-13