Incidental Mutation 'R0718:Ccni'
Institutional Source Beutler Lab
Gene Symbol Ccni
Ensembl Gene ENSMUSG00000063015
Gene Namecyclin I
MMRRC Submission 038900-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0718 (G1)
Quality Score98
Status Validated
Chromosomal Location93181933-93206495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93202316 bp
Amino Acid Change Proline to Serine at position 35 (P35S)
Ref Sequence ENSEMBL: ENSMUSP00000050189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031330] [ENSMUST00000058550] [ENSMUST00000144514] [ENSMUST00000151568]
Predicted Effect probably benign
Transcript: ENSMUST00000031330
Predicted Effect probably benign
Transcript: ENSMUST00000058550
AA Change: P35S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000050189
Gene: ENSMUSG00000063015
AA Change: P35S

CYCLIN 50 136 1.18e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144514
AA Change: P35S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122434
Gene: ENSMUSG00000063015
AA Change: P35S

Pfam:Cyclin_N 14 81 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151568
AA Change: P35S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116224
Gene: ENSMUSG00000063015
AA Change: P35S

CYCLIN 50 136 1.18e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201993
Meta Mutation Damage Score 0.0663 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin shows the highest similarity with cyclin G. The transcript of this gene was found to be expressed constantly during cell cycle progression. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile and do not display any gross physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,679,608 Y811N possibly damaging Het
Adrm1 T C 2: 180,175,147 probably benign Het
Alms1 T A 6: 85,621,821 S1210T probably benign Het
Ampd3 C T 7: 110,777,808 P11L probably damaging Het
Arhgap5 A G 12: 52,516,507 E87G possibly damaging Het
Armc5 C T 7: 128,240,070 probably benign Het
Asic2 C G 11: 80,971,456 probably benign Het
Asph A G 4: 9,514,683 probably benign Het
Bicd2 T A 13: 49,377,875 probably null Het
Brip1 A G 11: 86,143,305 L530P possibly damaging Het
Bsn G T 9: 108,111,360 probably benign Het
Btnl4 T A 17: 34,469,634 H390L probably benign Het
Ccdc70 A C 8: 21,973,308 K38T probably damaging Het
Cdh17 A G 4: 11,810,451 D714G possibly damaging Het
Cenpf A G 1: 189,653,984 L2033P probably damaging Het
Cfap69 A T 5: 5,621,924 M328K probably damaging Het
Cmah T G 13: 24,417,210 probably null Het
Cog6 T C 3: 53,010,629 T163A probably benign Het
Cyp2j8 G A 4: 96,501,196 S130F probably benign Het
Dgki A G 6: 37,012,896 V636A probably damaging Het
Dmkn T A 7: 30,764,786 probably benign Het
Dnah6 A G 6: 73,035,293 I3679T possibly damaging Het
Dsp A T 13: 38,196,764 Y2495F possibly damaging Het
Exosc4 C T 15: 76,329,489 A171V probably benign Het
Fbxw24 A G 9: 109,623,509 probably benign Het
Flvcr1 A T 1: 191,025,582 L171Q probably damaging Het
Fsd1 G T 17: 55,996,445 probably null Het
Gm7732 A G 17: 21,129,844 noncoding transcript Het
H2-K2 A C 17: 33,975,623 noncoding transcript Het
Hgf A G 5: 16,593,859 N295S probably damaging Het
Ift88 T A 14: 57,517,413 D811E probably benign Het
Igsf9b T A 9: 27,323,361 probably null Het
Immt T A 6: 71,863,172 V311E probably damaging Het
Ipo11 T A 13: 106,919,611 N51I possibly damaging Het
Isy1 T C 6: 87,819,176 K260E probably damaging Het
Jchain T G 5: 88,526,202 I28L probably benign Het
Jmjd1c T A 10: 67,218,946 probably null Het
Kif13b T C 14: 64,751,662 probably benign Het
Klhdc7b T C 15: 89,388,169 Y427H possibly damaging Het
Klhl8 T C 5: 103,876,293 probably benign Het
Lrp2 C T 2: 69,510,948 D963N probably damaging Het
Ltbp3 G T 19: 5,746,748 probably benign Het
Ltf C A 9: 111,040,379 Q41K probably benign Het
Med4 T A 14: 73,516,657 I148N probably damaging Het
Mlh3 T G 12: 85,247,697 S1242R possibly damaging Het
Mllt6 T C 11: 97,676,359 probably benign Het
Mpdz A G 4: 81,292,473 I1712T possibly damaging Het
Mrgprb4 T A 7: 48,198,553 H209L probably benign Het
Nkapl A T 13: 21,468,440 M1K probably null Het
Nmur2 T A 11: 56,029,498 probably benign Het
Nsun2 T A 13: 69,543,697 probably benign Het
Olfr1082 G A 2: 86,594,081 T249I probably benign Het
Olfr1130 A G 2: 87,607,927 I180V probably benign Het
Ovgp1 T C 3: 105,974,830 probably benign Het
Pcdh8 A G 14: 79,770,691 V144A possibly damaging Het
Pcnx3 G A 19: 5,677,728 probably benign Het
Pla2r1 C A 2: 60,479,530 V570L possibly damaging Het
Plxnd1 C A 6: 115,966,638 E1202D possibly damaging Het
Ppp1r37 T C 7: 19,532,254 E529G probably benign Het
Prdm15 A G 16: 97,812,633 F496L possibly damaging Het
Prlhr A T 19: 60,468,005 V41D probably benign Het
Prlhr G T 19: 60,468,059 S23* probably null Het
Prpf4 C T 4: 62,414,540 probably benign Het
Psg26 C T 7: 18,475,235 R416H probably benign Het
Psg26 T C 7: 18,478,287 H381R probably benign Het
Ralgds T G 2: 28,549,116 M717R probably benign Het
Rbms1 T C 2: 60,842,412 N44D probably damaging Het
Rpa1 T C 11: 75,318,401 probably benign Het
Rprd2 T C 3: 95,766,387 N568S probably benign Het
Rptor A G 11: 119,872,376 M929V probably benign Het
Rspo1 T A 4: 125,007,149 C97S possibly damaging Het
Scin C T 12: 40,079,607 G396S probably damaging Het
Scn9a T C 2: 66,547,112 N409D probably damaging Het
Sf3b1 A G 1: 55,019,385 I15T probably damaging Het
Sh3bp2 T C 5: 34,555,495 V149A probably damaging Het
Slc39a12 T A 2: 14,407,426 probably benign Het
Sp9 G T 2: 73,273,827 A242S possibly damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tatdn3 G T 1: 191,052,849 probably benign Het
Tex14 G A 11: 87,499,613 V379I probably benign Het
Tmed6 T C 8: 107,061,724 N197S probably damaging Het
Ttbk2 G A 2: 120,748,575 L689F probably benign Het
Ttbk2 A T 2: 120,745,160 I1043N probably benign Het
Ttn A G 2: 76,810,696 S5283P probably damaging Het
Ube3b C A 5: 114,402,555 S441* probably null Het
Ush2a G A 1: 188,797,830 C3272Y probably damaging Het
Vac14 T A 8: 110,632,477 I95K probably damaging Het
Vangl2 G A 1: 172,006,217 A433V probably damaging Het
Vwa5b1 A T 4: 138,608,824 V153D probably damaging Het
Zfhx3 T A 8: 108,955,650 D3240E unknown Het
Zfp945 A G 17: 22,851,030 C632R probably damaging Het
Zfyve26 G A 12: 79,265,802 probably benign Het
Zyg11b A T 4: 108,242,076 I606N possibly damaging Het
Other mutations in Ccni
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02301:Ccni APN 5 93188175 missense possibly damaging 0.77
IGL02545:Ccni APN 5 93187777 missense probably benign 0.01
IGL02865:Ccni APN 5 93183336 missense probably benign 0.04
R0234:Ccni UTSW 5 93202327 missense probably benign 0.02
R0234:Ccni UTSW 5 93202327 missense probably benign 0.02
R0541:Ccni UTSW 5 93187704 missense probably benign 0.00
R0760:Ccni UTSW 5 93183329 missense possibly damaging 0.89
R1656:Ccni UTSW 5 93188074 splice site probably null
R1752:Ccni UTSW 5 93202456 start gained probably benign
R1817:Ccni UTSW 5 93188108 missense possibly damaging 0.89
R3551:Ccni UTSW 5 93187761 missense probably benign 0.05
R3552:Ccni UTSW 5 93187761 missense probably benign 0.05
R3956:Ccni UTSW 5 93183404 missense probably damaging 1.00
R4809:Ccni UTSW 5 93187570 intron probably benign
R4901:Ccni UTSW 5 93183144 missense probably damaging 1.00
R4937:Ccni UTSW 5 93188254 splice site probably null
R4975:Ccni UTSW 5 93187694 missense possibly damaging 0.83
R7120:Ccni UTSW 5 93183331 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTAAACGAGCCttttgcttccttga -3'

Sequencing Primer
(F):5'- tgcttccttgagacacagtc -3'
Posted On2013-07-30