Incidental Mutation 'R8225:Sytl2'
ID636936
Institutional Source Beutler Lab
Gene Symbol Sytl2
Ensembl Gene ENSMUSG00000030616
Gene Namesynaptotagmin-like 2
SynonymsSlp2-a, Slp2-b, Slp2-d, Slp2-c, Slp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R8225 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location90302252-90410719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90375517 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 238 (A238T)
Ref Sequence ENSEMBL: ENSMUSP00000139865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107210] [ENSMUST00000107211] [ENSMUST00000190731] [ENSMUST00000190837] [ENSMUST00000207578] [ENSMUST00000208720]
Predicted Effect probably benign
Transcript: ENSMUST00000107210
AA Change: A238T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102828
Gene: ENSMUSG00000030616
AA Change: A238T

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.5e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
C2 620 725 4.59e-15 SMART
C2 769 872 6.44e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107211
AA Change: A238T

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102829
Gene: ENSMUSG00000030616
AA Change: A238T

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 592 620 N/A INTRINSIC
C2 644 749 4.59e-15 SMART
C2 793 896 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190731
AA Change: A238T

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139865
Gene: ENSMUSG00000030616
AA Change: A238T

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.8e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
C2 660 765 4.59e-15 SMART
C2 809 912 6.44e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190837
AA Change: A211T

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139450
Gene: ENSMUSG00000030616
AA Change: A211T

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 82 93 N/A INTRINSIC
low complexity region 165 178 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 581 609 N/A INTRINSIC
C2 633 738 4.59e-15 SMART
C2 782 885 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207578
Predicted Effect possibly damaging
Transcript: ENSMUST00000208720
AA Change: A238T

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display abnormal gastric surface mucus cell morphology and reduced basal mucin secretion from gastric cells [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,826,516 N82S probably benign Het
Ago3 A T 4: 126,353,739 L595Q probably damaging Het
Bpifc T C 10: 86,000,567 T25A probably benign Het
Bsn T A 9: 108,107,106 T478S Het
Cacna1d A G 14: 30,123,033 V720A probably benign Het
Cd109 G T 9: 78,661,690 K350N probably damaging Het
Cdk6 C A 5: 3,390,790 P115T probably benign Het
Clock T C 5: 76,241,912 N363S probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dock10 T A 1: 80,503,730 K517* probably null Het
Dynlt1a G T 17: 6,311,353 Q71K probably damaging Het
E330021D16Rik A T 6: 136,401,112 L240Q probably damaging Het
Epb41l3 C T 17: 69,274,801 T591I possibly damaging Het
Exosc10 G A 4: 148,565,204 V364I possibly damaging Het
Fabp3-ps1 A G 10: 86,732,234 I52T noncoding transcript Het
Fndc3a T C 14: 72,557,677 Q766R probably benign Het
Gm10608 CACACACACAGA CA 9: 119,160,708 probably null Het
Gm10645 C T 8: 83,165,838 R80H unknown Het
Gm7849 T C 8: 21,456,402 D39G possibly damaging Het
Gpr146 A T 5: 139,392,616 M58L probably benign Het
Gzf1 T A 2: 148,690,844 F639L probably benign Het
Kars T C 8: 112,003,338 I136V probably benign Het
Kcnj3 G A 2: 55,437,714 V172M probably damaging Het
Kcnk10 A G 12: 98,440,590 probably null Het
Nagpa C A 16: 5,198,860 D334Y probably damaging Het
Nsun2 T C 13: 69,612,374 I57T possibly damaging Het
Olfr1461 A T 19: 13,165,143 N43I probably damaging Het
Pax8 A T 2: 24,422,971 L432Q probably damaging Het
Plxna4 A G 6: 32,162,103 L1710P probably damaging Het
Prdm16 A G 4: 154,355,245 probably null Het
Qrich2 A G 11: 116,454,068 L1721P probably damaging Het
Sbsn TCCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATG TCCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATG 7: 30,751,994 probably benign Het
Sbsn T C 7: 30,752,444 F295L probably benign Het
Slc4a7 C T 14: 14,738,224 R153* probably null Het
Sult6b2 A T 6: 142,804,329 M21K probably benign Het
Swt1 A C 1: 151,422,108 S23A possibly damaging Het
Synm A C 7: 67,759,049 S194A probably benign Het
Tax1bp1 G A 6: 52,744,355 probably null Het
Tfr2 G A 5: 137,571,463 A74T possibly damaging Het
Tns1 G A 1: 73,985,887 T389I probably damaging Het
Trpm2 C T 10: 77,947,973 R222Q probably damaging Het
Trpm4 A G 7: 45,305,334 C1094R probably benign Het
Uty T C Y: 1,158,634 S471G probably benign Het
Vipr1 A T 9: 121,642,849 M1L possibly damaging Het
Vps13b A G 15: 35,794,382 R2313G probably damaging Het
Xrn1 T A 9: 96,035,667 C1301S probably benign Het
Ythdc1 A T 5: 86,816,937 S164C possibly damaging Het
Ythdc1 G T 5: 86,816,938 S164I possibly damaging Het
Zbtb9 T A 17: 26,974,785 I388N probably damaging Het
Zfp521 T C 18: 13,845,302 I685V probably benign Het
Other mutations in Sytl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Sytl2 APN 7 90372905 missense probably benign 0.25
IGL00657:Sytl2 APN 7 90401410 missense probably benign 0.40
IGL00788:Sytl2 APN 7 90382698 intron probably benign
IGL00834:Sytl2 APN 7 90382636 intron probably benign
IGL01833:Sytl2 APN 7 90396537 missense probably damaging 0.99
IGL01866:Sytl2 APN 7 90381839 intron probably benign
IGL02215:Sytl2 APN 7 90381214 intron probably benign
IGL02934:Sytl2 APN 7 90375992 missense probably benign 0.00
IGL03095:Sytl2 APN 7 90392434 missense probably damaging 1.00
finder UTSW 7 90375652 missense probably damaging 1.00
keeper UTSW 7 90358224 nonsense probably null
R0126:Sytl2 UTSW 7 90396589 missense probably damaging 1.00
R0269:Sytl2 UTSW 7 90403020 splice site probably benign
R0270:Sytl2 UTSW 7 90403020 splice site probably benign
R0271:Sytl2 UTSW 7 90403020 splice site probably benign
R0288:Sytl2 UTSW 7 90403020 splice site probably benign
R0528:Sytl2 UTSW 7 90403020 splice site probably benign
R0601:Sytl2 UTSW 7 90395166 missense probably damaging 1.00
R0610:Sytl2 UTSW 7 90380853 intron probably benign
R1634:Sytl2 UTSW 7 90395182 missense probably damaging 1.00
R1777:Sytl2 UTSW 7 90403052 missense probably benign 0.25
R2040:Sytl2 UTSW 7 90381861 intron probably benign
R3788:Sytl2 UTSW 7 90376081 missense probably benign 0.00
R3843:Sytl2 UTSW 7 90360159 missense possibly damaging 0.77
R3952:Sytl2 UTSW 7 90381492 intron probably benign
R4082:Sytl2 UTSW 7 90408427 missense possibly damaging 0.88
R4600:Sytl2 UTSW 7 90375769 missense probably benign 0.11
R4651:Sytl2 UTSW 7 90375425 missense probably damaging 1.00
R4724:Sytl2 UTSW 7 90348792 start codon destroyed probably null 1.00
R4730:Sytl2 UTSW 7 90381249 intron probably benign
R4870:Sytl2 UTSW 7 90388898 missense probably damaging 1.00
R4959:Sytl2 UTSW 7 90376037 missense probably damaging 0.97
R4995:Sytl2 UTSW 7 90382257 intron probably benign
R5009:Sytl2 UTSW 7 90381315 intron probably benign
R5096:Sytl2 UTSW 7 90376082 missense possibly damaging 0.49
R5191:Sytl2 UTSW 7 90375652 missense probably damaging 1.00
R5305:Sytl2 UTSW 7 90381863 intron probably benign
R5538:Sytl2 UTSW 7 90388906 missense probably benign 0.03
R5792:Sytl2 UTSW 7 90375689 missense probably damaging 0.98
R6378:Sytl2 UTSW 7 90358224 nonsense probably null
R6982:Sytl2 UTSW 7 90396564 missense probably damaging 0.96
R7456:Sytl2 UTSW 7 90348847 missense probably damaging 1.00
R7600:Sytl2 UTSW 7 90376144 missense probably benign 0.00
R8127:Sytl2 UTSW 7 90375590 missense possibly damaging 0.93
R8171:Sytl2 UTSW 7 90409470 missense probably damaging 1.00
R8297:Sytl2 UTSW 7 90385075 missense probably benign
R8843:Sytl2 UTSW 7 90376126 missense probably benign 0.03
R8929:Sytl2 UTSW 7 90375602 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCAGACTAAGCTTAGGTCTCCC -3'
(R):5'- AGGCCAGGTGATAGGATTTTGC -3'

Sequencing Primer
(F):5'- AGGTCTCCCTTAAATTGTAGAGTTGC -3'
(R):5'- ATAGGATTTTGCTTTTCGGATCAAG -3'
Posted On2020-07-13