Incidental Mutation 'R8225:Bsn'
ID636942
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
MMRRC Submission
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R8225 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108107106 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 478 (T478S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: T3250S
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: T3250S

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,826,516 N82S probably benign Het
Ago3 A T 4: 126,353,739 L595Q probably damaging Het
Bpifc T C 10: 86,000,567 T25A probably benign Het
Cacna1d A G 14: 30,123,033 V720A probably benign Het
Cd109 G T 9: 78,661,690 K350N probably damaging Het
Cdk6 C A 5: 3,390,790 P115T probably benign Het
Clock T C 5: 76,241,912 N363S probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dock10 T A 1: 80,503,730 K517* probably null Het
Dynlt1a G T 17: 6,311,353 Q71K probably damaging Het
E330021D16Rik A T 6: 136,401,112 L240Q probably damaging Het
Epb41l3 C T 17: 69,274,801 T591I possibly damaging Het
Exosc10 G A 4: 148,565,204 V364I possibly damaging Het
Fabp3-ps1 A G 10: 86,732,234 I52T noncoding transcript Het
Fndc3a T C 14: 72,557,677 Q766R probably benign Het
Gm10608 CACACACACAGA CA 9: 119,160,708 probably null Het
Gm10645 C T 8: 83,165,838 R80H unknown Het
Gm7849 T C 8: 21,456,402 D39G possibly damaging Het
Gpr146 A T 5: 139,392,616 M58L probably benign Het
Gzf1 T A 2: 148,690,844 F639L probably benign Het
Kars T C 8: 112,003,338 I136V probably benign Het
Kcnj3 G A 2: 55,437,714 V172M probably damaging Het
Kcnk10 A G 12: 98,440,590 probably null Het
Nagpa C A 16: 5,198,860 D334Y probably damaging Het
Nsun2 T C 13: 69,612,374 I57T possibly damaging Het
Olfr1461 A T 19: 13,165,143 N43I probably damaging Het
Pax8 A T 2: 24,422,971 L432Q probably damaging Het
Plxna4 A G 6: 32,162,103 L1710P probably damaging Het
Prdm16 A G 4: 154,355,245 probably null Het
Qrich2 A G 11: 116,454,068 L1721P probably damaging Het
Sbsn TCCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATG TCCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATG 7: 30,751,994 probably benign Het
Sbsn T C 7: 30,752,444 F295L probably benign Het
Slc4a7 C T 14: 14,738,224 R153* probably null Het
Sult6b2 A T 6: 142,804,329 M21K probably benign Het
Swt1 A C 1: 151,422,108 S23A possibly damaging Het
Synm A C 7: 67,759,049 S194A probably benign Het
Sytl2 G A 7: 90,375,517 A238T probably benign Het
Tax1bp1 G A 6: 52,744,355 probably null Het
Tfr2 G A 5: 137,571,463 A74T possibly damaging Het
Tns1 G A 1: 73,985,887 T389I probably damaging Het
Trpm2 C T 10: 77,947,973 R222Q probably damaging Het
Trpm4 A G 7: 45,305,334 C1094R probably benign Het
Uty T C Y: 1,158,634 S471G probably benign Het
Vipr1 A T 9: 121,642,849 M1L possibly damaging Het
Vps13b A G 15: 35,794,382 R2313G probably damaging Het
Xrn1 T A 9: 96,035,667 C1301S probably benign Het
Ythdc1 A T 5: 86,816,937 S164C possibly damaging Het
Ythdc1 G T 5: 86,816,938 S164I possibly damaging Het
Zbtb9 T A 17: 26,974,785 I388N probably damaging Het
Zfp521 T C 18: 13,845,302 I685V probably benign Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7960:Bsn UTSW 9 108115548 missense probably damaging 1.00
R8022:Bsn UTSW 9 108114404 missense probably benign 0.01
R8056:Bsn UTSW 9 108105307 missense
R8158:Bsn UTSW 9 108110033 missense unknown
R8161:Bsn UTSW 9 108139530 missense probably benign 0.20
R8282:Bsn UTSW 9 108107691 missense possibly damaging 0.73
R8296:Bsn UTSW 9 108117379 missense probably benign 0.00
R8415:Bsn UTSW 9 108111452 missense probably benign 0.00
R8417:Bsn UTSW 9 108111452 missense probably benign 0.00
R8426:Bsn UTSW 9 108126573 missense probably damaging 1.00
R8437:Bsn UTSW 9 108111452 missense probably benign 0.00
R8438:Bsn UTSW 9 108111452 missense probably benign 0.00
R8439:Bsn UTSW 9 108111452 missense probably benign 0.00
R8440:Bsn UTSW 9 108111452 missense probably benign 0.00
R8441:Bsn UTSW 9 108111452 missense probably benign 0.00
R8442:Bsn UTSW 9 108111452 missense probably benign 0.00
R8513:Bsn UTSW 9 108114510 missense possibly damaging 0.65
R8529:Bsn UTSW 9 108111452 missense probably benign 0.00
R8535:Bsn UTSW 9 108111452 missense probably benign 0.00
R8546:Bsn UTSW 9 108111452 missense probably benign 0.00
R8548:Bsn UTSW 9 108111452 missense probably benign 0.00
R8549:Bsn UTSW 9 108111452 missense probably benign 0.00
R8682:Bsn UTSW 9 108106169 missense
R8773:Bsn UTSW 9 108110505 missense unknown
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499 missense
Z1177:Bsn UTSW 9 108139195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGACCAGATTTCCCACGG -3'
(R):5'- TGCTGTCACCATGTCTTCAG -3'

Sequencing Primer
(F):5'- ACGGGGGTCATATGAGTCCTC -3'
(R):5'- TGAAACCGGCTACAGTGGTC -3'
Posted On2020-07-13