Incidental Mutation 'R8225:Bpifc'
ID636946
Institutional Source Beutler Lab
Gene Symbol Bpifc
Ensembl Gene ENSMUSG00000050108
Gene NameBPI fold containing family C
SynonymsBpil2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R8225 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location85959340-86011895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86000567 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 25 (T25A)
Ref Sequence ENSEMBL: ENSMUSP00000063107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061699] [ENSMUST00000105304]
Predicted Effect probably benign
Transcript: ENSMUST00000061699
AA Change: T25A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063107
Gene: ENSMUSG00000050108
AA Change: T25A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
BPI1 33 257 8.89e-23 SMART
BPI2 272 474 2.29e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105304
AA Change: T25A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000100941
Gene: ENSMUSG00000050108
AA Change: T25A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCOP:d1ewfa1 26 82 2e-13 SMART
Blast:BPI1 33 82 7e-27 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,826,516 N82S probably benign Het
Ago3 A T 4: 126,353,739 L595Q probably damaging Het
Bsn T A 9: 108,107,106 T478S Het
Cacna1d A G 14: 30,123,033 V720A probably benign Het
Cd109 G T 9: 78,661,690 K350N probably damaging Het
Cdk6 C A 5: 3,390,790 P115T probably benign Het
Clock T C 5: 76,241,912 N363S probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dock10 T A 1: 80,503,730 K517* probably null Het
Dynlt1a G T 17: 6,311,353 Q71K probably damaging Het
E330021D16Rik A T 6: 136,401,112 L240Q probably damaging Het
Epb41l3 C T 17: 69,274,801 T591I possibly damaging Het
Exosc10 G A 4: 148,565,204 V364I possibly damaging Het
Fabp3-ps1 A G 10: 86,732,234 I52T noncoding transcript Het
Fndc3a T C 14: 72,557,677 Q766R probably benign Het
Gm10608 CACACACACAGA CA 9: 119,160,708 probably null Het
Gm10645 C T 8: 83,165,838 R80H unknown Het
Gm7849 T C 8: 21,456,402 D39G possibly damaging Het
Gpr146 A T 5: 139,392,616 M58L probably benign Het
Gzf1 T A 2: 148,690,844 F639L probably benign Het
Kars T C 8: 112,003,338 I136V probably benign Het
Kcnj3 G A 2: 55,437,714 V172M probably damaging Het
Kcnk10 A G 12: 98,440,590 probably null Het
Nagpa C A 16: 5,198,860 D334Y probably damaging Het
Nsun2 T C 13: 69,612,374 I57T possibly damaging Het
Olfr1461 A T 19: 13,165,143 N43I probably damaging Het
Pax8 A T 2: 24,422,971 L432Q probably damaging Het
Plxna4 A G 6: 32,162,103 L1710P probably damaging Het
Prdm16 A G 4: 154,355,245 probably null Het
Qrich2 A G 11: 116,454,068 L1721P probably damaging Het
Sbsn TCCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATG TCCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATGAAACCCACCATGCTTTTGGTCAGGGTGGGAATGTGGCAGACAAGTTAGGTCATG 7: 30,751,994 probably benign Het
Sbsn T C 7: 30,752,444 F295L probably benign Het
Slc4a7 C T 14: 14,738,224 R153* probably null Het
Sult6b2 A T 6: 142,804,329 M21K probably benign Het
Swt1 A C 1: 151,422,108 S23A possibly damaging Het
Synm A C 7: 67,759,049 S194A probably benign Het
Sytl2 G A 7: 90,375,517 A238T probably benign Het
Tax1bp1 G A 6: 52,744,355 probably null Het
Tfr2 G A 5: 137,571,463 A74T possibly damaging Het
Tns1 G A 1: 73,985,887 T389I probably damaging Het
Trpm2 C T 10: 77,947,973 R222Q probably damaging Het
Trpm4 A G 7: 45,305,334 C1094R probably benign Het
Uty T C Y: 1,158,634 S471G probably benign Het
Vipr1 A T 9: 121,642,849 M1L possibly damaging Het
Vps13b A G 15: 35,794,382 R2313G probably damaging Het
Xrn1 T A 9: 96,035,667 C1301S probably benign Het
Ythdc1 A T 5: 86,816,937 S164C possibly damaging Het
Ythdc1 G T 5: 86,816,938 S164I possibly damaging Het
Zbtb9 T A 17: 26,974,785 I388N probably damaging Het
Zfp521 T C 18: 13,845,302 I685V probably benign Het
Other mutations in Bpifc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Bpifc APN 10 85960528 missense possibly damaging 0.85
IGL01474:Bpifc APN 10 86000639 start codon destroyed probably damaging 0.98
IGL02437:Bpifc APN 10 85988731 missense probably damaging 1.00
R0689:Bpifc UTSW 10 85960547 splice site probably benign
R1205:Bpifc UTSW 10 85981304 missense probably damaging 1.00
R1524:Bpifc UTSW 10 85977735 missense probably benign 0.01
R2033:Bpifc UTSW 10 86000632 missense possibly damaging 0.88
R3103:Bpifc UTSW 10 85993422 missense probably damaging 1.00
R3609:Bpifc UTSW 10 86000638 start codon destroyed probably null 1.00
R3874:Bpifc UTSW 10 85991254 missense probably benign
R4728:Bpifc UTSW 10 85991199 missense possibly damaging 0.50
R5079:Bpifc UTSW 10 85981304 missense probably damaging 1.00
R5193:Bpifc UTSW 10 86000633 missense probably benign 0.01
R6280:Bpifc UTSW 10 85977712 missense probably benign 0.02
R6291:Bpifc UTSW 10 85976258 missense probably damaging 1.00
R6945:Bpifc UTSW 10 85979214 missense probably benign 0.00
R7288:Bpifc UTSW 10 85988721 missense possibly damaging 0.95
R7310:Bpifc UTSW 10 85963027 missense probably damaging 1.00
R7463:Bpifc UTSW 10 85979334 missense probably benign 0.00
R7807:Bpifc UTSW 10 85976250 missense possibly damaging 0.80
R8004:Bpifc UTSW 10 85979284 missense probably benign
R8284:Bpifc UTSW 10 86000549 missense probably benign 0.00
Z1176:Bpifc UTSW 10 85965228 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAGAACTGACGCGCACATC -3'
(R):5'- TGCATAAGTGGGTCAGCAAATG -3'

Sequencing Primer
(F):5'- CCATGCAGGTAGACCTCAGATCTG -3'
(R):5'- AGGCCTAGATGGATAGGTAAAATTAG -3'
Posted On2020-07-13