Incidental Mutation 'R0718:Ube3b'
ID 63695
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission 038900-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0718 (G1)
Quality Score 147
Status Validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 114540616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 441 (S441*)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably null
Transcript: ENSMUST00000074002
AA Change: S441*
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: S441*

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183408
Predicted Effect unknown
Transcript: ENSMUST00000196651
AA Change: F161L
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577
AA Change: F161L

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,586,918 (GRCm39) Y811N possibly damaging Het
Adrm1 T C 2: 179,816,940 (GRCm39) probably benign Het
Alms1 T A 6: 85,598,803 (GRCm39) S1210T probably benign Het
Ampd3 C T 7: 110,377,015 (GRCm39) P11L probably damaging Het
Arhgap5 A G 12: 52,563,290 (GRCm39) E87G possibly damaging Het
Armc5 C T 7: 127,839,242 (GRCm39) probably benign Het
Asic2 C G 11: 80,862,282 (GRCm39) probably benign Het
Asph A G 4: 9,514,683 (GRCm39) probably benign Het
Bicd2 T A 13: 49,531,351 (GRCm39) probably null Het
Brip1 A G 11: 86,034,131 (GRCm39) L530P possibly damaging Het
Bsn G T 9: 107,988,559 (GRCm39) probably benign Het
Btnl4 T A 17: 34,688,608 (GRCm39) H390L probably benign Het
Ccdc70 A C 8: 22,463,324 (GRCm39) K38T probably damaging Het
Ccni G A 5: 93,350,175 (GRCm39) P35S probably benign Het
Cdh17 A G 4: 11,810,451 (GRCm39) D714G possibly damaging Het
Cenpf A G 1: 189,386,181 (GRCm39) L2033P probably damaging Het
Cfap69 A T 5: 5,671,924 (GRCm39) M328K probably damaging Het
Cmah T G 13: 24,601,193 (GRCm39) probably null Het
Cog6 T C 3: 52,918,050 (GRCm39) T163A probably benign Het
Cyp2j8 G A 4: 96,389,433 (GRCm39) S130F probably benign Het
Dgki A G 6: 36,989,831 (GRCm39) V636A probably damaging Het
Dmkn T A 7: 30,464,211 (GRCm39) probably benign Het
Dnah6 A G 6: 73,012,276 (GRCm39) I3679T possibly damaging Het
Dsp A T 13: 38,380,740 (GRCm39) Y2495F possibly damaging Het
Exosc4 C T 15: 76,213,689 (GRCm39) A171V probably benign Het
Fbxw24 A G 9: 109,452,577 (GRCm39) probably benign Het
Flvcr1 A T 1: 190,757,779 (GRCm39) L171Q probably damaging Het
Fsd1 G T 17: 56,303,445 (GRCm39) probably null Het
Gm7732 A G 17: 21,350,106 (GRCm39) noncoding transcript Het
H2-K2 A C 17: 34,194,597 (GRCm39) noncoding transcript Het
Hgf A G 5: 16,798,857 (GRCm39) N295S probably damaging Het
Ift88 T A 14: 57,754,870 (GRCm39) D811E probably benign Het
Igsf9b T A 9: 27,234,657 (GRCm39) probably null Het
Immt T A 6: 71,840,156 (GRCm39) V311E probably damaging Het
Ipo11 T A 13: 107,056,119 (GRCm39) N51I possibly damaging Het
Isy1 T C 6: 87,796,158 (GRCm39) K260E probably damaging Het
Jchain T G 5: 88,674,061 (GRCm39) I28L probably benign Het
Jmjd1c T A 10: 67,054,725 (GRCm39) probably null Het
Kif13b T C 14: 64,989,111 (GRCm39) probably benign Het
Klhdc7b T C 15: 89,272,372 (GRCm39) Y427H possibly damaging Het
Klhl8 T C 5: 104,024,159 (GRCm39) probably benign Het
Lrp2 C T 2: 69,341,292 (GRCm39) D963N probably damaging Het
Ltbp3 G T 19: 5,796,776 (GRCm39) probably benign Het
Ltf C A 9: 110,869,447 (GRCm39) Q41K probably benign Het
Med4 T A 14: 73,754,097 (GRCm39) I148N probably damaging Het
Mlh3 T G 12: 85,294,471 (GRCm39) S1242R possibly damaging Het
Mllt6 T C 11: 97,567,185 (GRCm39) probably benign Het
Mpdz A G 4: 81,210,710 (GRCm39) I1712T possibly damaging Het
Mrgprb4 T A 7: 47,848,301 (GRCm39) H209L probably benign Het
Nkapl A T 13: 21,652,610 (GRCm39) M1K probably null Het
Nmur2 T A 11: 55,920,324 (GRCm39) probably benign Het
Nsun2 T A 13: 69,691,816 (GRCm39) probably benign Het
Or10ag60 A G 2: 87,438,271 (GRCm39) I180V probably benign Het
Or8k35 G A 2: 86,424,425 (GRCm39) T249I probably benign Het
Ovgp1 T C 3: 105,882,146 (GRCm39) probably benign Het
Pcdh8 A G 14: 80,008,131 (GRCm39) V144A possibly damaging Het
Pcnx3 G A 19: 5,727,756 (GRCm39) probably benign Het
Pla2r1 C A 2: 60,309,874 (GRCm39) V570L possibly damaging Het
Plxnd1 C A 6: 115,943,599 (GRCm39) E1202D possibly damaging Het
Ppp1r37 T C 7: 19,266,179 (GRCm39) E529G probably benign Het
Prdm15 A G 16: 97,613,833 (GRCm39) F496L possibly damaging Het
Prlhr G T 19: 60,456,497 (GRCm39) S23* probably null Het
Prlhr A T 19: 60,456,443 (GRCm39) V41D probably benign Het
Prpf4 C T 4: 62,332,777 (GRCm39) probably benign Het
Psg26 C T 7: 18,209,160 (GRCm39) R416H probably benign Het
Psg26 T C 7: 18,212,212 (GRCm39) H381R probably benign Het
Ralgds T G 2: 28,439,128 (GRCm39) M717R probably benign Het
Rbms1 T C 2: 60,672,756 (GRCm39) N44D probably damaging Het
Rpa1 T C 11: 75,209,227 (GRCm39) probably benign Het
Rprd2 T C 3: 95,673,699 (GRCm39) N568S probably benign Het
Rptor A G 11: 119,763,202 (GRCm39) M929V probably benign Het
Rspo1 T A 4: 124,900,942 (GRCm39) C97S possibly damaging Het
Scin C T 12: 40,129,606 (GRCm39) G396S probably damaging Het
Scn9a T C 2: 66,377,456 (GRCm39) N409D probably damaging Het
Sf3b1 A G 1: 55,058,544 (GRCm39) I15T probably damaging Het
Sh3bp2 T C 5: 34,712,839 (GRCm39) V149A probably damaging Het
Slc39a12 T A 2: 14,412,237 (GRCm39) probably benign Het
Sp9 G T 2: 73,104,171 (GRCm39) A242S possibly damaging Het
Srr A G 11: 74,801,891 (GRCm39) V126A possibly damaging Het
Tatdn3 G T 1: 190,785,046 (GRCm39) probably benign Het
Tex14 G A 11: 87,390,439 (GRCm39) V379I probably benign Het
Tmed6 T C 8: 107,788,356 (GRCm39) N197S probably damaging Het
Ttbk2 A T 2: 120,575,641 (GRCm39) I1043N probably benign Het
Ttbk2 G A 2: 120,579,056 (GRCm39) L689F probably benign Het
Ttn A G 2: 76,641,040 (GRCm39) S5283P probably damaging Het
Ush2a G A 1: 188,530,027 (GRCm39) C3272Y probably damaging Het
Vac14 T A 8: 111,359,109 (GRCm39) I95K probably damaging Het
Vangl2 G A 1: 171,833,784 (GRCm39) A433V probably damaging Het
Vwa5b1 A T 4: 138,336,135 (GRCm39) V153D probably damaging Het
Zfhx3 T A 8: 109,682,282 (GRCm39) D3240E unknown Het
Zfp945 A G 17: 23,070,004 (GRCm39) C632R probably damaging Het
Zfyve26 G A 12: 79,312,576 (GRCm39) probably benign Het
Zyg11b A T 4: 108,099,273 (GRCm39) I606N possibly damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GCGATTACTGCCTGAACTGCTAACC -3'
(R):5'- ACTGCCTGACAACCTTGGAAGTG -3'

Sequencing Primer
(F):5'- gtgggcagaggtggtgg -3'
(R):5'- CAACCTTGGAAGTGGGAGC -3'
Posted On 2013-07-30