Mutagenetix > Incidental Mutations

Incidental Mutation 'R0718:Ube3b'

63695

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

038900-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0718 (G1)

Quality Score

147

Status

Validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 114402555 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 441 (S441*)

Ref Sequence

ENSEMBL: ENSMUSP00000073652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

Predicted Effect

probably null
Transcript: ENSMUST00000074002
AA Change: S441*

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: S441*

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150630

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183408

Predicted Effect

unknown
Transcript: ENSMUST00000196651
AA Change: F161L

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577
AA Change: F161L

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Meta Mutation Damage Score

0.57

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl4	A	T	3: 95,679,608	Y811N	possibly damaging	Het
Adrm1	T	C	2: 180,175,147		probably benign	Het
Alms1	T	A	6: 85,621,821	S1210T	probably benign	Het
Ampd3	C	T	7: 110,777,808	P11L	probably damaging	Het
Arhgap5	A	G	12: 52,516,507	E87G	possibly damaging	Het
Armc5	C	T	7: 128,240,070		probably benign	Het
Asic2	C	G	11: 80,971,456		probably benign	Het
Asph	A	G	4: 9,514,683		probably benign	Het
Bicd2	T	A	13: 49,377,875		probably null	Het
Brip1	A	G	11: 86,143,305	L530P	possibly damaging	Het
Bsn	G	T	9: 108,111,360		probably benign	Het
Btnl4	T	A	17: 34,469,634	H390L	probably benign	Het
Ccdc70	A	C	8: 21,973,308	K38T	probably damaging	Het
Ccni	G	A	5: 93,202,316	P35S	probably benign	Het
Cdh17	A	G	4: 11,810,451	D714G	possibly damaging	Het
Cenpf	A	G	1: 189,653,984	L2033P	probably damaging	Het
Cfap69	A	T	5: 5,621,924	M328K	probably damaging	Het
Cmah	T	G	13: 24,417,210		probably null	Het
Cog6	T	C	3: 53,010,629	T163A	probably benign	Het
Cyp2j8	G	A	4: 96,501,196	S130F	probably benign	Het
Dgki	A	G	6: 37,012,896	V636A	probably damaging	Het
Dmkn	T	A	7: 30,764,786		probably benign	Het
Dnah6	A	G	6: 73,035,293	I3679T	possibly damaging	Het
Dsp	A	T	13: 38,196,764	Y2495F	possibly damaging	Het
Exosc4	C	T	15: 76,329,489	A171V	probably benign	Het
Fbxw24	A	G	9: 109,623,509		probably benign	Het
Flvcr1	A	T	1: 191,025,582	L171Q	probably damaging	Het
Fsd1	G	T	17: 55,996,445		probably null	Het
Gm7732	A	G	17: 21,129,844		noncoding transcript	Het
H2-K2	A	C	17: 33,975,623		noncoding transcript	Het
Hgf	A	G	5: 16,593,859	N295S	probably damaging	Het
Ift88	T	A	14: 57,517,413	D811E	probably benign	Het
Igsf9b	T	A	9: 27,323,361		probably null	Het
Immt	T	A	6: 71,863,172	V311E	probably damaging	Het
Ipo11	T	A	13: 106,919,611	N51I	possibly damaging	Het
Isy1	T	C	6: 87,819,176	K260E	probably damaging	Het
Jchain	T	G	5: 88,526,202	I28L	probably benign	Het
Jmjd1c	T	A	10: 67,218,946		probably null	Het
Kif13b	T	C	14: 64,751,662		probably benign	Het
Klhdc7b	T	C	15: 89,388,169	Y427H	possibly damaging	Het
Klhl8	T	C	5: 103,876,293		probably benign	Het
Lrp2	C	T	2: 69,510,948	D963N	probably damaging	Het
Ltbp3	G	T	19: 5,746,748		probably benign	Het
Ltf	C	A	9: 111,040,379	Q41K	probably benign	Het
Med4	T	A	14: 73,516,657	I148N	probably damaging	Het
Mlh3	T	G	12: 85,247,697	S1242R	possibly damaging	Het
Mllt6	T	C	11: 97,676,359		probably benign	Het
Mpdz	A	G	4: 81,292,473	I1712T	possibly damaging	Het
Mrgprb4	T	A	7: 48,198,553	H209L	probably benign	Het
Nkapl	A	T	13: 21,468,440	M1K	probably null	Het
Nmur2	T	A	11: 56,029,498		probably benign	Het
Nsun2	T	A	13: 69,543,697		probably benign	Het
Olfr1082	G	A	2: 86,594,081	T249I	probably benign	Het
Olfr1130	A	G	2: 87,607,927	I180V	probably benign	Het
Ovgp1	T	C	3: 105,974,830		probably benign	Het
Pcdh8	A	G	14: 79,770,691	V144A	possibly damaging	Het
Pcnx3	G	A	19: 5,677,728		probably benign	Het
Pla2r1	C	A	2: 60,479,530	V570L	possibly damaging	Het
Plxnd1	C	A	6: 115,966,638	E1202D	possibly damaging	Het
Ppp1r37	T	C	7: 19,532,254	E529G	probably benign	Het
Prdm15	A	G	16: 97,812,633	F496L	possibly damaging	Het
Prlhr	A	T	19: 60,468,005	V41D	probably benign	Het
Prlhr	G	T	19: 60,468,059	S23*	probably null	Het
Prpf4	C	T	4: 62,414,540		probably benign	Het
Psg26	C	T	7: 18,475,235	R416H	probably benign	Het
Psg26	T	C	7: 18,478,287	H381R	probably benign	Het
Ralgds	T	G	2: 28,549,116	M717R	probably benign	Het
Rbms1	T	C	2: 60,842,412	N44D	probably damaging	Het
Rpa1	T	C	11: 75,318,401		probably benign	Het
Rprd2	T	C	3: 95,766,387	N568S	probably benign	Het
Rptor	A	G	11: 119,872,376	M929V	probably benign	Het
Rspo1	T	A	4: 125,007,149	C97S	possibly damaging	Het
Scin	C	T	12: 40,079,607	G396S	probably damaging	Het
Scn9a	T	C	2: 66,547,112	N409D	probably damaging	Het
Sf3b1	A	G	1: 55,019,385	I15T	probably damaging	Het
Sh3bp2	T	C	5: 34,555,495	V149A	probably damaging	Het
Slc39a12	T	A	2: 14,407,426		probably benign	Het
Sp9	G	T	2: 73,273,827	A242S	possibly damaging	Het
Srr	A	G	11: 74,911,065	V126A	possibly damaging	Het
Tatdn3	G	T	1: 191,052,849		probably benign	Het
Tex14	G	A	11: 87,499,613	V379I	probably benign	Het
Tmed6	T	C	8: 107,061,724	N197S	probably damaging	Het
Ttbk2	G	A	2: 120,748,575	L689F	probably benign	Het
Ttbk2	A	T	2: 120,745,160	I1043N	probably benign	Het
Ttn	A	G	2: 76,810,696	S5283P	probably damaging	Het
Ush2a	G	A	1: 188,797,830	C3272Y	probably damaging	Het
Vac14	T	A	8: 110,632,477	I95K	probably damaging	Het
Vangl2	G	A	1: 172,006,217	A433V	probably damaging	Het
Vwa5b1	A	T	4: 138,608,824	V153D	probably damaging	Het
Zfhx3	T	A	8: 108,955,650	D3240E	unknown	Het
Zfp945	A	G	17: 22,851,030	C632R	probably damaging	Het
Zfyve26	G	A	12: 79,265,802		probably benign	Het
Zyg11b	A	T	4: 108,242,076	I606N	possibly damaging	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	intron	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	intron	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- GCGATTACTGCCTGAACTGCTAACC -3'
(R):5'- ACTGCCTGACAACCTTGGAAGTG -3'

Sequencing Primer
(F):5'- gtgggcagaggtggtgg -3'
(R):5'- CAACCTTGGAAGTGGGAGC -3'

Posted On

2013-07-30