Incidental Mutation 'R0718:Immt'
ID63697
Institutional Source Beutler Lab
Gene Symbol Immt
Ensembl Gene ENSMUSG00000052337
Gene Nameinner membrane protein, mitochondrial
Synonymsmitofilin, D830041H16Rik, P87/89, P89, P87, 1700082C19Rik, HMP
MMRRC Submission 038900-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R0718 (G1)
Quality Score140
Status Validated
Chromosome6
Chromosomal Location71831331-71877388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71863172 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 311 (V311E)
Ref Sequence ENSEMBL: ENSMUSP00000145872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064062] [ENSMUST00000101301] [ENSMUST00000114151] [ENSMUST00000165331] [ENSMUST00000166938] [ENSMUST00000166975] [ENSMUST00000207003]
Predicted Effect probably damaging
Transcript: ENSMUST00000064062
AA Change: V354E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066181
Gene: ENSMUSG00000052337
AA Change: V354E

DomainStartEndE-ValueType
Pfam:Mitofilin 40 745 5e-207 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101301
AA Change: V343E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098859
Gene: ENSMUSG00000052337
AA Change: V343E

DomainStartEndE-ValueType
Pfam:Mitofilin 40 734 3.9e-177 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114151
AA Change: V311E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109788
Gene: ENSMUSG00000052337
AA Change: V311E

DomainStartEndE-ValueType
Pfam:Mitofilin 40 697 1.3e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165331
SMART Domains Protein: ENSMUSP00000128834
Gene: ENSMUSG00000052337

DomainStartEndE-ValueType
Pfam:Mitofilin 40 265 2.6e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166938
AA Change: V276E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128967
Gene: ENSMUSG00000052337
AA Change: V276E

DomainStartEndE-ValueType
Pfam:Mitofilin 40 667 3.6e-166 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166975
AA Change: V276E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128367
Gene: ENSMUSG00000052337
AA Change: V276E

DomainStartEndE-ValueType
Pfam:Mitofilin 40 467 1.1e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205371
Predicted Effect probably damaging
Transcript: ENSMUST00000207003
AA Change: V311E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3064 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,679,608 Y811N possibly damaging Het
Adrm1 T C 2: 180,175,147 probably benign Het
Alms1 T A 6: 85,621,821 S1210T probably benign Het
Ampd3 C T 7: 110,777,808 P11L probably damaging Het
Arhgap5 A G 12: 52,516,507 E87G possibly damaging Het
Armc5 C T 7: 128,240,070 probably benign Het
Asic2 C G 11: 80,971,456 probably benign Het
Asph A G 4: 9,514,683 probably benign Het
Bicd2 T A 13: 49,377,875 probably null Het
Brip1 A G 11: 86,143,305 L530P possibly damaging Het
Bsn G T 9: 108,111,360 probably benign Het
Btnl4 T A 17: 34,469,634 H390L probably benign Het
Ccdc70 A C 8: 21,973,308 K38T probably damaging Het
Ccni G A 5: 93,202,316 P35S probably benign Het
Cdh17 A G 4: 11,810,451 D714G possibly damaging Het
Cenpf A G 1: 189,653,984 L2033P probably damaging Het
Cfap69 A T 5: 5,621,924 M328K probably damaging Het
Cmah T G 13: 24,417,210 probably null Het
Cog6 T C 3: 53,010,629 T163A probably benign Het
Cyp2j8 G A 4: 96,501,196 S130F probably benign Het
Dgki A G 6: 37,012,896 V636A probably damaging Het
Dmkn T A 7: 30,764,786 probably benign Het
Dnah6 A G 6: 73,035,293 I3679T possibly damaging Het
Dsp A T 13: 38,196,764 Y2495F possibly damaging Het
Exosc4 C T 15: 76,329,489 A171V probably benign Het
Fbxw24 A G 9: 109,623,509 probably benign Het
Flvcr1 A T 1: 191,025,582 L171Q probably damaging Het
Fsd1 G T 17: 55,996,445 probably null Het
Gm7732 A G 17: 21,129,844 noncoding transcript Het
H2-K2 A C 17: 33,975,623 noncoding transcript Het
Hgf A G 5: 16,593,859 N295S probably damaging Het
Ift88 T A 14: 57,517,413 D811E probably benign Het
Igsf9b T A 9: 27,323,361 probably null Het
Ipo11 T A 13: 106,919,611 N51I possibly damaging Het
Isy1 T C 6: 87,819,176 K260E probably damaging Het
Jchain T G 5: 88,526,202 I28L probably benign Het
Jmjd1c T A 10: 67,218,946 probably null Het
Kif13b T C 14: 64,751,662 probably benign Het
Klhdc7b T C 15: 89,388,169 Y427H possibly damaging Het
Klhl8 T C 5: 103,876,293 probably benign Het
Lrp2 C T 2: 69,510,948 D963N probably damaging Het
Ltbp3 G T 19: 5,746,748 probably benign Het
Ltf C A 9: 111,040,379 Q41K probably benign Het
Med4 T A 14: 73,516,657 I148N probably damaging Het
Mlh3 T G 12: 85,247,697 S1242R possibly damaging Het
Mllt6 T C 11: 97,676,359 probably benign Het
Mpdz A G 4: 81,292,473 I1712T possibly damaging Het
Mrgprb4 T A 7: 48,198,553 H209L probably benign Het
Nkapl A T 13: 21,468,440 M1K probably null Het
Nmur2 T A 11: 56,029,498 probably benign Het
Nsun2 T A 13: 69,543,697 probably benign Het
Olfr1082 G A 2: 86,594,081 T249I probably benign Het
Olfr1130 A G 2: 87,607,927 I180V probably benign Het
Ovgp1 T C 3: 105,974,830 probably benign Het
Pcdh8 A G 14: 79,770,691 V144A possibly damaging Het
Pcnx3 G A 19: 5,677,728 probably benign Het
Pla2r1 C A 2: 60,479,530 V570L possibly damaging Het
Plxnd1 C A 6: 115,966,638 E1202D possibly damaging Het
Ppp1r37 T C 7: 19,532,254 E529G probably benign Het
Prdm15 A G 16: 97,812,633 F496L possibly damaging Het
Prlhr A T 19: 60,468,005 V41D probably benign Het
Prlhr G T 19: 60,468,059 S23* probably null Het
Prpf4 C T 4: 62,414,540 probably benign Het
Psg26 C T 7: 18,475,235 R416H probably benign Het
Psg26 T C 7: 18,478,287 H381R probably benign Het
Ralgds T G 2: 28,549,116 M717R probably benign Het
Rbms1 T C 2: 60,842,412 N44D probably damaging Het
Rpa1 T C 11: 75,318,401 probably benign Het
Rprd2 T C 3: 95,766,387 N568S probably benign Het
Rptor A G 11: 119,872,376 M929V probably benign Het
Rspo1 T A 4: 125,007,149 C97S possibly damaging Het
Scin C T 12: 40,079,607 G396S probably damaging Het
Scn9a T C 2: 66,547,112 N409D probably damaging Het
Sf3b1 A G 1: 55,019,385 I15T probably damaging Het
Sh3bp2 T C 5: 34,555,495 V149A probably damaging Het
Slc39a12 T A 2: 14,407,426 probably benign Het
Sp9 G T 2: 73,273,827 A242S possibly damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tatdn3 G T 1: 191,052,849 probably benign Het
Tex14 G A 11: 87,499,613 V379I probably benign Het
Tmed6 T C 8: 107,061,724 N197S probably damaging Het
Ttbk2 G A 2: 120,748,575 L689F probably benign Het
Ttbk2 A T 2: 120,745,160 I1043N probably benign Het
Ttn A G 2: 76,810,696 S5283P probably damaging Het
Ube3b C A 5: 114,402,555 S441* probably null Het
Ush2a G A 1: 188,797,830 C3272Y probably damaging Het
Vac14 T A 8: 110,632,477 I95K probably damaging Het
Vangl2 G A 1: 172,006,217 A433V probably damaging Het
Vwa5b1 A T 4: 138,608,824 V153D probably damaging Het
Zfhx3 T A 8: 108,955,650 D3240E unknown Het
Zfp945 A G 17: 22,851,030 C632R probably damaging Het
Zfyve26 G A 12: 79,265,802 probably benign Het
Zyg11b A T 4: 108,242,076 I606N possibly damaging Het
Other mutations in Immt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01974:Immt APN 6 71872858 missense probably damaging 0.99
IGL02085:Immt APN 6 71851836 missense probably benign 0.30
IGL02493:Immt APN 6 71844716 splice site probably benign
glut UTSW 6 71861040 missense probably damaging 1.00
P0045:Immt UTSW 6 71868617 missense possibly damaging 0.88
R0106:Immt UTSW 6 71851844 missense probably benign 0.22
R0106:Immt UTSW 6 71851844 missense probably benign 0.22
R0565:Immt UTSW 6 71846483 splice site probably benign
R0671:Immt UTSW 6 71871557 missense possibly damaging 0.95
R0676:Immt UTSW 6 71851844 missense probably benign 0.22
R0789:Immt UTSW 6 71861067 missense probably damaging 1.00
R0980:Immt UTSW 6 71874326 missense probably benign 0.19
R1332:Immt UTSW 6 71846272 splice site probably benign
R1688:Immt UTSW 6 71857011 missense probably damaging 1.00
R2106:Immt UTSW 6 71871515 missense possibly damaging 0.80
R2149:Immt UTSW 6 71844675 nonsense probably null
R3706:Immt UTSW 6 71862362 missense probably benign 0.01
R4393:Immt UTSW 6 71872800 missense probably benign 0.04
R4543:Immt UTSW 6 71851778 missense probably damaging 0.97
R4645:Immt UTSW 6 71856939 missense probably damaging 1.00
R4774:Immt UTSW 6 71852736 missense probably damaging 1.00
R5535:Immt UTSW 6 71852784 missense probably null 1.00
R5920:Immt UTSW 6 71863196 missense probably benign 0.18
R7002:Immt UTSW 6 71861040 missense probably damaging 1.00
R7266:Immt UTSW 6 71874705 missense probably benign 0.26
R7326:Immt UTSW 6 71846369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAGGGGAGACTTCACAACATGATA -3'
(R):5'- TGATTGGGACATAGAAGCACTGGGA -3'

Sequencing Primer
(F):5'- tgaacacacacacacaaacac -3'
(R):5'- CACTGGGATTTAAAGACTGGAGTTG -3'
Posted On2013-07-30