Mutagenetix > Incidental Mutations

Incidental Mutation 'R8226:Nr4a3'

636976

Institutional Source

Beutler Lab

Gene Symbol

Nr4a3

Ensembl Gene

ENSMUSG00000028341

Gene Name

nuclear receptor subfamily 4, group A, member 3

Synonyms

Nor1, TEC, MINOR, NOR-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8226 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48045153-48086447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 48056588 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Methionine at position 380 (K380M)

Ref Sequence

ENSEMBL: ENSMUSP00000030025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030025]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030025
AA Change: K380M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: K380M

Domain	Start	End	E-Value	Type
Blast:HOLI	1	43	4e-18	BLAST
low complexity region	99	115	N/A	INTRINSIC
low complexity region	139	151	N/A	INTRINSIC
low complexity region	196	210	N/A	INTRINSIC
low complexity region	218	239	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
ZnF_C4	290	361	4.57e-39	SMART
low complexity region	376	396	N/A	INTRINSIC
HOLI	440	595	2.46e-21	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: K409M

Domain	Start	End	E-Value	Type
Blast:HOLI	30	73	8e-19	BLAST
low complexity region	129	145	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC
low complexity region	226	240	N/A	INTRINSIC
low complexity region	248	269	N/A	INTRINSIC
low complexity region	299	318	N/A	INTRINSIC
ZnF_C4	320	391	4.57e-39	SMART
low complexity region	406	426	N/A	INTRINSIC
HOLI	470	625	2.46e-21	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.2%
20x: 97.7%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	A	G	10: 29,218,199	N27S	probably damaging	Het
Abcb1b	T	A	5: 8,821,390	Y315N	probably damaging	Het
Acy1	A	G	9: 106,437,658	I22T	probably damaging	Het
Akap11	G	A	14: 78,511,209	T1246M		Het
Akr1b3	G	C	6: 34,311,932	T114R	probably damaging	Het
Apob	G	A	12: 8,009,056	V2513I	probably benign	Het
Arhgap21	C	T	2: 20,871,745	D820N	probably damaging	Het
Arl2	A	T	19: 6,137,476		probably null	Het
BC080695	T	G	4: 143,571,960	Y158D	probably benign	Het
Bmp5	C	T	9: 75,776,324	P78S	probably damaging	Het
Cic	T	C	7: 25,287,788	C1374R	probably damaging	Het
Dennd5b	T	C	6: 149,014,248		probably null	Het
Dhx36	A	G	3: 62,470,570	Y1000H	probably benign	Het
Dnah14	A	G	1: 181,795,545	E3996G	possibly damaging	Het
Efcab6	T	C	15: 83,904,255	Y946C	probably benign	Het
Egfem1	A	G	3: 29,657,255	K328E	probably damaging	Het
F5	T	C	1: 164,194,390	V1478A	probably benign	Het
Fchsd2	C	T	7: 101,282,472	P745L	probably damaging	Het
Gm15448	A	C	7: 3,825,110	L66R		Het
Gm9573	T	C	17: 35,619,707		probably benign	Het
Grb10	G	T	11: 11,951,533	L214M	probably damaging	Het
H6pd	A	G	4: 149,995,989	V133A	probably benign	Het
Irak4	T	A	15: 94,558,363	L277Q	probably damaging	Het
Krt78	A	T	15: 101,947,045	M777K	possibly damaging	Het
Lrch4	A	G	5: 137,639,735	H93R		Het
Lrrc38	G	A	4: 143,350,733	G189R	probably damaging	Het
Mga	A	G	2: 119,960,385	I2251V	probably benign	Het
Mtx3	A	G	13: 92,847,707	E164G	possibly damaging	Het
Nbeal1	A	T	1: 60,277,177	K1846N	probably damaging	Het
Nedd1	T	A	10: 92,691,935	M466L	probably benign	Het
Nup107	T	C	10: 117,757,931	K786E	probably benign	Het
Olfr1024	T	C	2: 85,904,203	I284V	probably benign	Het
Olfr110	A	T	17: 37,498,669	Q6L	probably benign	Het
Olfr560	T	C	7: 102,753,743	Y62C	probably benign	Het
Olfr995	T	A	2: 85,438,637	I174F	probably damaging	Het
Pkhd1l1	A	G	15: 44,574,407	N3533D	possibly damaging	Het
Plpp1	A	T	13: 112,866,931	T230S	probably benign	Het
Plxnc1	A	C	10: 94,833,368	D1063E	possibly damaging	Het
Prokr2	C	A	2: 132,374,041	A167S	probably damaging	Het
Qser1	C	T	2: 104,788,725	A491T	probably benign	Het
Rc3h2	T	A	2: 37,376,989	Y1040F	possibly damaging	Het
Rgl2	C	T	17: 33,932,527	L182F	possibly damaging	Het
Rnf130	T	C	11: 50,071,270	V181A	probably benign	Het
Scd4	A	G	19: 44,334,133	D55G	probably benign	Het
Scn7a	T	G	2: 66,700,860	I558L	possibly damaging	Het
Serpinb7	G	A	1: 107,448,250		probably null	Het
Shtn1	T	C	19: 59,003,896	I417V	possibly damaging	Het
Svs3b	T	A	2: 164,256,220	E60D	possibly damaging	Het
Tex14	T	C	11: 87,484,759	I116T	probably damaging	Het
Trak1	C	T	9: 121,451,727	T394I	probably benign	Het
Trhde	C	T	10: 114,567,228	V497M	probably damaging	Het
Trpc2	A	G	7: 102,088,275	M425V	possibly damaging	Het
Trpm2	C	T	10: 77,947,973	R222Q	probably damaging	Het
Tuba1b	C	T	15: 98,931,710	G410S	probably benign	Het
Usp28	T	G	9: 49,015,397		probably null	Het
Vps13d	T	C	4: 145,149,290	Y1555C		Het
Wdr17	T	A	8: 54,693,120	N106Y	possibly damaging	Het

Other mutations in Nr4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Nr4a3	APN	4	48051586	missense	possibly damaging	0.48
IGL01407:Nr4a3	APN	4	48083201	missense	probably benign	0.00
IGL01454:Nr4a3	APN	4	48067803	missense	probably damaging	1.00
IGL01472:Nr4a3	APN	4	48071133	missense	probably damaging	1.00
IGL02622:Nr4a3	APN	4	48051649	missense	probably benign	0.06
IGL03401:Nr4a3	APN	4	48070987	splice site	probably null
bulbous	UTSW	4	48083255	missense	probably damaging	0.98
cronus	UTSW	4	48056539	missense	probably damaging	1.00
I1329:Nr4a3	UTSW	4	48051585	missense	probably benign	0.12
R0486:Nr4a3	UTSW	4	48056525	splice site	probably benign
R0610:Nr4a3	UTSW	4	48051903	missense	probably benign	0.10
R1170:Nr4a3	UTSW	4	48051564	missense	probably damaging	0.98
R1170:Nr4a3	UTSW	4	48083324	missense	probably benign	0.01
R1440:Nr4a3	UTSW	4	48051777	missense	probably benign
R1977:Nr4a3	UTSW	4	48056539	missense	probably damaging	1.00
R2016:Nr4a3	UTSW	4	48083252	missense	probably damaging	1.00
R2046:Nr4a3	UTSW	4	48067807	missense	possibly damaging	0.82
R2055:Nr4a3	UTSW	4	48067771	missense	possibly damaging	0.86
R3707:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R3708:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R4246:Nr4a3	UTSW	4	48083125	missense	possibly damaging	0.86
R4657:Nr4a3	UTSW	4	48051522	missense	probably damaging	1.00
R4870:Nr4a3	UTSW	4	48051651	missense	possibly damaging	0.73
R5434:Nr4a3	UTSW	4	48067861	missense	probably damaging	1.00
R5539:Nr4a3	UTSW	4	48056525	splice site	probably null
R5663:Nr4a3	UTSW	4	48055931	missense	probably damaging	1.00
R6513:Nr4a3	UTSW	4	48083255	missense	probably damaging	0.98
R6664:Nr4a3	UTSW	4	48056006	missense	probably damaging	1.00
R6921:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R6940:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R7076:Nr4a3	UTSW	4	48055957	missense	probably damaging	1.00
R7322:Nr4a3	UTSW	4	48083238	missense	probably benign	0.00
R7347:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7348:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7349:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7361:Nr4a3	UTSW	4	48083203	missense	probably benign	0.00
R7365:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7366:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7418:Nr4a3	UTSW	4	48051476	missense	probably damaging	1.00
R7659:Nr4a3	UTSW	4	48051269	missense	probably damaging	1.00
R7895:Nr4a3	UTSW	4	48051390	missense	probably benign
R7986:Nr4a3	UTSW	4	48055954	missense	probably damaging	1.00
R8022:Nr4a3	UTSW	4	48051510	missense	probably damaging	1.00
R8328:Nr4a3	UTSW	4	48051323	missense	probably damaging	1.00
R8349:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40
R8403:Nr4a3	UTSW	4	48051348	missense	probably damaging	1.00
R8449:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- AACACTGCTCTGAAATGGGG -3'
(R):5'- GCCAGGCACAGTCATTTAAC -3'

Sequencing Primer
(F):5'- CTCTGAAATGGGGGCGGG -3'
(R):5'- GGCACAGTCATTTAACTAACTCTTGC -3'

Posted On

2020-07-13