Incidental Mutation 'R8226:Nr4a3'
ID636976
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8226 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48056588 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 380 (K380M)
Ref Sequence ENSEMBL: ENSMUSP00000030025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect probably damaging
Transcript: ENSMUST00000030025
AA Change: K380M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: K380M

DomainStartEndE-ValueType
Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: K409M

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,218,199 N27S probably damaging Het
Abcb1b T A 5: 8,821,390 Y315N probably damaging Het
Acy1 A G 9: 106,437,658 I22T probably damaging Het
Akap11 G A 14: 78,511,209 T1246M Het
Akr1b3 G C 6: 34,311,932 T114R probably damaging Het
Apob G A 12: 8,009,056 V2513I probably benign Het
Arhgap21 C T 2: 20,871,745 D820N probably damaging Het
Arl2 A T 19: 6,137,476 probably null Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp5 C T 9: 75,776,324 P78S probably damaging Het
Cic T C 7: 25,287,788 C1374R probably damaging Het
Dennd5b T C 6: 149,014,248 probably null Het
Dhx36 A G 3: 62,470,570 Y1000H probably benign Het
Dnah14 A G 1: 181,795,545 E3996G possibly damaging Het
Efcab6 T C 15: 83,904,255 Y946C probably benign Het
Egfem1 A G 3: 29,657,255 K328E probably damaging Het
F5 T C 1: 164,194,390 V1478A probably benign Het
Fchsd2 C T 7: 101,282,472 P745L probably damaging Het
Gm15448 A C 7: 3,825,110 L66R Het
Gm9573 T C 17: 35,619,707 probably benign Het
Grb10 G T 11: 11,951,533 L214M probably damaging Het
H6pd A G 4: 149,995,989 V133A probably benign Het
Irak4 T A 15: 94,558,363 L277Q probably damaging Het
Krt78 A T 15: 101,947,045 M777K possibly damaging Het
Lrch4 A G 5: 137,639,735 H93R Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mga A G 2: 119,960,385 I2251V probably benign Het
Mtx3 A G 13: 92,847,707 E164G possibly damaging Het
Nbeal1 A T 1: 60,277,177 K1846N probably damaging Het
Nedd1 T A 10: 92,691,935 M466L probably benign Het
Nup107 T C 10: 117,757,931 K786E probably benign Het
Olfr1024 T C 2: 85,904,203 I284V probably benign Het
Olfr110 A T 17: 37,498,669 Q6L probably benign Het
Olfr560 T C 7: 102,753,743 Y62C probably benign Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Pkhd1l1 A G 15: 44,574,407 N3533D possibly damaging Het
Plpp1 A T 13: 112,866,931 T230S probably benign Het
Plxnc1 A C 10: 94,833,368 D1063E possibly damaging Het
Prokr2 C A 2: 132,374,041 A167S probably damaging Het
Qser1 C T 2: 104,788,725 A491T probably benign Het
Rc3h2 T A 2: 37,376,989 Y1040F possibly damaging Het
Rgl2 C T 17: 33,932,527 L182F possibly damaging Het
Rnf130 T C 11: 50,071,270 V181A probably benign Het
Scd4 A G 19: 44,334,133 D55G probably benign Het
Scn7a T G 2: 66,700,860 I558L possibly damaging Het
Serpinb7 G A 1: 107,448,250 probably null Het
Shtn1 T C 19: 59,003,896 I417V possibly damaging Het
Svs3b T A 2: 164,256,220 E60D possibly damaging Het
Tex14 T C 11: 87,484,759 I116T probably damaging Het
Trak1 C T 9: 121,451,727 T394I probably benign Het
Trhde C T 10: 114,567,228 V497M probably damaging Het
Trpc2 A G 7: 102,088,275 M425V possibly damaging Het
Trpm2 C T 10: 77,947,973 R222Q probably damaging Het
Tuba1b C T 15: 98,931,710 G410S probably benign Het
Usp28 T G 9: 49,015,397 probably null Het
Vps13d T C 4: 145,149,290 Y1555C Het
Wdr17 T A 8: 54,693,120 N106Y possibly damaging Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0486:Nr4a3 UTSW 4 48056525 splice site probably benign
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2016:Nr4a3 UTSW 4 48083252 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R2055:Nr4a3 UTSW 4 48067771 missense possibly damaging 0.86
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R3708:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4246:Nr4a3 UTSW 4 48083125 missense possibly damaging 0.86
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5539:Nr4a3 UTSW 4 48056525 splice site probably null
R5663:Nr4a3 UTSW 4 48055931 missense probably damaging 1.00
R6513:Nr4a3 UTSW 4 48083255 missense probably damaging 0.98
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6921:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R6940:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
R7659:Nr4a3 UTSW 4 48051269 missense probably damaging 1.00
R7895:Nr4a3 UTSW 4 48051390 missense probably benign
R7986:Nr4a3 UTSW 4 48055954 missense probably damaging 1.00
R8022:Nr4a3 UTSW 4 48051510 missense probably damaging 1.00
R8328:Nr4a3 UTSW 4 48051323 missense probably damaging 1.00
R8349:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
R8403:Nr4a3 UTSW 4 48051348 missense probably damaging 1.00
R8449:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AACACTGCTCTGAAATGGGG -3'
(R):5'- GCCAGGCACAGTCATTTAAC -3'

Sequencing Primer
(F):5'- CTCTGAAATGGGGGCGGG -3'
(R):5'- GGCACAGTCATTTAACTAACTCTTGC -3'
Posted On2020-07-13