Incidental Mutation 'R8226:Lrrc38'
ID 636977
Institutional Source Beutler Lab
Gene Symbol Lrrc38
Ensembl Gene ENSMUSG00000028584
Gene Name leucine rich repeat containing 38
Synonyms A230053A07Rik
MMRRC Submission 067643-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R8226 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 143076327-143097602 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 143077303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 189 (G189R)
Ref Sequence ENSEMBL: ENSMUSP00000053597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052458]
AlphaFold A2VDH3
Predicted Effect probably damaging
Transcript: ENSMUST00000052458
AA Change: G189R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053597
Gene: ENSMUSG00000028584
AA Change: G189R

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
LRRNT 31 64 2.82e-4 SMART
LRR 84 106 1.37e1 SMART
LRR 108 130 5.26e0 SMART
LRR 132 154 2.27e1 SMART
LRR 155 178 8.09e-1 SMART
LRRCT 190 244 8.63e-6 SMART
transmembrane domain 252 274 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Meta Mutation Damage Score 0.1238 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.7%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,094,195 (GRCm39) N27S probably damaging Het
Abcb1b T A 5: 8,871,390 (GRCm39) Y315N probably damaging Het
Acy1 A G 9: 106,314,857 (GRCm39) I22T probably damaging Het
Akap11 G A 14: 78,748,649 (GRCm39) T1246M Het
Akr1b1 G C 6: 34,288,867 (GRCm39) T114R probably damaging Het
Apob G A 12: 8,059,056 (GRCm39) V2513I probably benign Het
Arhgap21 C T 2: 20,876,556 (GRCm39) D820N probably damaging Het
Arl2 A T 19: 6,187,506 (GRCm39) probably null Het
Bmp5 C T 9: 75,683,606 (GRCm39) P78S probably damaging Het
Cic T C 7: 24,987,213 (GRCm39) C1374R probably damaging Het
Dennd5b T C 6: 148,915,746 (GRCm39) probably null Het
Dhx36 A G 3: 62,377,991 (GRCm39) Y1000H probably benign Het
Dnah14 A G 1: 181,623,110 (GRCm39) E3996G possibly damaging Het
Efcab6 T C 15: 83,788,456 (GRCm39) Y946C probably benign Het
Egfem1 A G 3: 29,711,404 (GRCm39) K328E probably damaging Het
F5 T C 1: 164,021,959 (GRCm39) V1478A probably benign Het
Fchsd2 C T 7: 100,931,679 (GRCm39) P745L probably damaging Het
Grb10 G T 11: 11,901,533 (GRCm39) L214M probably damaging Het
H6pd A G 4: 150,080,446 (GRCm39) V133A probably benign Het
Irak4 T A 15: 94,456,244 (GRCm39) L277Q probably damaging Het
Krt78 A T 15: 101,855,480 (GRCm39) M777K possibly damaging Het
Lrch4 A G 5: 137,637,997 (GRCm39) H93R Het
Mga A G 2: 119,790,866 (GRCm39) I2251V probably benign Het
Mtx3 A G 13: 92,984,215 (GRCm39) E164G possibly damaging Het
Muc21 T C 17: 35,930,599 (GRCm39) probably benign Het
Nbeal1 A T 1: 60,316,336 (GRCm39) K1846N probably damaging Het
Nedd1 T A 10: 92,527,797 (GRCm39) M466L probably benign Het
Nr4a3 A T 4: 48,056,588 (GRCm39) K380M probably damaging Het
Nup107 T C 10: 117,593,836 (GRCm39) K786E probably benign Het
Or51f23b T C 7: 102,402,950 (GRCm39) Y62C probably benign Het
Or5ak25 T A 2: 85,268,981 (GRCm39) I174F probably damaging Het
Or5m12 T C 2: 85,734,547 (GRCm39) I284V probably benign Het
Or5v1 A T 17: 37,809,560 (GRCm39) Q6L probably benign Het
Pira13 A C 7: 3,828,109 (GRCm39) L66R Het
Pkhd1l1 A G 15: 44,437,803 (GRCm39) N3533D possibly damaging Het
Plpp1 A T 13: 113,003,465 (GRCm39) T230S probably benign Het
Plxnc1 A C 10: 94,669,230 (GRCm39) D1063E possibly damaging Het
Pramel20 T G 4: 143,298,530 (GRCm39) Y158D probably benign Het
Prokr2 C A 2: 132,215,961 (GRCm39) A167S probably damaging Het
Qser1 C T 2: 104,619,070 (GRCm39) A491T probably benign Het
Rc3h2 T A 2: 37,267,001 (GRCm39) Y1040F possibly damaging Het
Rgl2 C T 17: 34,151,501 (GRCm39) L182F possibly damaging Het
Rnf130 T C 11: 49,962,097 (GRCm39) V181A probably benign Het
Scd4 A G 19: 44,322,572 (GRCm39) D55G probably benign Het
Scn7a T G 2: 66,531,204 (GRCm39) I558L possibly damaging Het
Serpinb7 G A 1: 107,375,980 (GRCm39) probably null Het
Shtn1 T C 19: 58,992,328 (GRCm39) I417V possibly damaging Het
Svs3b T A 2: 164,098,140 (GRCm39) E60D possibly damaging Het
Tex14 T C 11: 87,375,585 (GRCm39) I116T probably damaging Het
Trak1 C T 9: 121,280,793 (GRCm39) T394I probably benign Het
Trhde C T 10: 114,403,133 (GRCm39) V497M probably damaging Het
Trpc2 A G 7: 101,737,482 (GRCm39) M425V possibly damaging Het
Trpm2 C T 10: 77,783,807 (GRCm39) R222Q probably damaging Het
Tuba1b C T 15: 98,829,591 (GRCm39) G410S probably benign Het
Usp28 T G 9: 48,926,697 (GRCm39) probably null Het
Vps13d T C 4: 144,875,860 (GRCm39) Y1555C Het
Wdr17 T A 8: 55,146,155 (GRCm39) N106Y possibly damaging Het
Other mutations in Lrrc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0281:Lrrc38 UTSW 4 143,076,979 (GRCm39) missense probably damaging 0.99
R0545:Lrrc38 UTSW 4 143,077,328 (GRCm39) missense probably benign 0.41
R1078:Lrrc38 UTSW 4 143,077,088 (GRCm39) missense probably benign 0.06
R1467:Lrrc38 UTSW 4 143,096,450 (GRCm39) missense probably damaging 1.00
R1467:Lrrc38 UTSW 4 143,096,450 (GRCm39) missense probably damaging 1.00
R1967:Lrrc38 UTSW 4 143,096,553 (GRCm39) missense unknown
R2221:Lrrc38 UTSW 4 143,096,419 (GRCm39) nonsense probably null
R2223:Lrrc38 UTSW 4 143,096,419 (GRCm39) nonsense probably null
R4061:Lrrc38 UTSW 4 143,077,076 (GRCm39) missense probably damaging 1.00
R4930:Lrrc38 UTSW 4 143,096,438 (GRCm39) missense probably damaging 0.98
R5585:Lrrc38 UTSW 4 143,076,961 (GRCm39) missense probably damaging 0.96
R6787:Lrrc38 UTSW 4 143,096,364 (GRCm39) missense probably benign 0.18
R7046:Lrrc38 UTSW 4 143,076,739 (GRCm39) start codon destroyed probably null
R7706:Lrrc38 UTSW 4 143,076,845 (GRCm39) missense probably damaging 1.00
R8189:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8190:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8192:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8219:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8221:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8223:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCTGAGCTACAACAAC -3'
(R):5'- TTTCTGGTGAGCCCCAAAACG -3'

Sequencing Primer
(F):5'- CAACCTCACCCAGCTGG -3'
(R):5'- GAGGCCTCACACATCCTG -3'
Posted On 2020-07-13