Incidental Mutation 'R8226:Akr1b3'
ID636983
Institutional Source Beutler Lab
Gene Symbol Akr1b3
Ensembl Gene ENSMUSG00000001642
Gene Namealdo-keto reductase family 1, member B3 (aldose reductase)
SynonymsAhr-1, Aldor1, Ahr1, ALR2, Aldr1, AR
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R8226 (G1)
Quality Score182.009
Status Validated
Chromosome6
Chromosomal Location34302434-34317478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 34311932 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 114 (T114R)
Ref Sequence ENSEMBL: ENSMUSP00000100045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102980] [ENSMUST00000154655]
Predicted Effect probably damaging
Transcript: ENSMUST00000102980
AA Change: T114R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100045
Gene: ENSMUSG00000001642
AA Change: T114R

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 13 294 4.1e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154655
AA Change: T137R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114391
Gene: ENSMUSG00000001642
AA Change: T137R

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 176 9.2e-27 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased drinking, increased urination, and dilation of the renal tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,218,199 N27S probably damaging Het
Abcb1b T A 5: 8,821,390 Y315N probably damaging Het
Acy1 A G 9: 106,437,658 I22T probably damaging Het
Akap11 G A 14: 78,511,209 T1246M Het
Apob G A 12: 8,009,056 V2513I probably benign Het
Arhgap21 C T 2: 20,871,745 D820N probably damaging Het
Arl2 A T 19: 6,137,476 probably null Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp5 C T 9: 75,776,324 P78S probably damaging Het
Cic T C 7: 25,287,788 C1374R probably damaging Het
Dennd5b T C 6: 149,014,248 probably null Het
Dhx36 A G 3: 62,470,570 Y1000H probably benign Het
Dnah14 A G 1: 181,795,545 E3996G possibly damaging Het
Efcab6 T C 15: 83,904,255 Y946C probably benign Het
Egfem1 A G 3: 29,657,255 K328E probably damaging Het
F5 T C 1: 164,194,390 V1478A probably benign Het
Fchsd2 C T 7: 101,282,472 P745L probably damaging Het
Gm15448 A C 7: 3,825,110 L66R Het
Gm9573 T C 17: 35,619,707 probably benign Het
Grb10 G T 11: 11,951,533 L214M probably damaging Het
H6pd A G 4: 149,995,989 V133A probably benign Het
Irak4 T A 15: 94,558,363 L277Q probably damaging Het
Krt78 A T 15: 101,947,045 M777K possibly damaging Het
Lrch4 A G 5: 137,639,735 H93R Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mga A G 2: 119,960,385 I2251V probably benign Het
Mtx3 A G 13: 92,847,707 E164G possibly damaging Het
Nbeal1 A T 1: 60,277,177 K1846N probably damaging Het
Nedd1 T A 10: 92,691,935 M466L probably benign Het
Nr4a3 A T 4: 48,056,588 K380M probably damaging Het
Nup107 T C 10: 117,757,931 K786E probably benign Het
Olfr1024 T C 2: 85,904,203 I284V probably benign Het
Olfr110 A T 17: 37,498,669 Q6L probably benign Het
Olfr560 T C 7: 102,753,743 Y62C probably benign Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Pkhd1l1 A G 15: 44,574,407 N3533D possibly damaging Het
Plpp1 A T 13: 112,866,931 T230S probably benign Het
Plxnc1 A C 10: 94,833,368 D1063E possibly damaging Het
Prokr2 C A 2: 132,374,041 A167S probably damaging Het
Qser1 C T 2: 104,788,725 A491T probably benign Het
Rc3h2 T A 2: 37,376,989 Y1040F possibly damaging Het
Rgl2 C T 17: 33,932,527 L182F possibly damaging Het
Rnf130 T C 11: 50,071,270 V181A probably benign Het
Scd4 A G 19: 44,334,133 D55G probably benign Het
Scn7a T G 2: 66,700,860 I558L possibly damaging Het
Serpinb7 G A 1: 107,448,250 probably null Het
Shtn1 T C 19: 59,003,896 I417V possibly damaging Het
Svs3b T A 2: 164,256,220 E60D possibly damaging Het
Tex14 T C 11: 87,484,759 I116T probably damaging Het
Trak1 C T 9: 121,451,727 T394I probably benign Het
Trhde C T 10: 114,567,228 V497M probably damaging Het
Trpc2 A G 7: 102,088,275 M425V possibly damaging Het
Trpm2 C T 10: 77,947,973 R222Q probably damaging Het
Tuba1b C T 15: 98,931,710 G410S probably benign Het
Usp28 T G 9: 49,015,397 probably null Het
Vps13d T C 4: 145,149,290 Y1555C Het
Wdr17 T A 8: 54,693,120 N106Y possibly damaging Het
Other mutations in Akr1b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Akr1b3 APN 6 34304319 missense probably damaging 1.00
R0567:Akr1b3 UTSW 6 34304345 splice site probably null
R0611:Akr1b3 UTSW 6 34309642 missense probably benign 0.02
R1564:Akr1b3 UTSW 6 34306535 splice site probably null
R2445:Akr1b3 UTSW 6 34310934 missense probably benign 0.26
R2507:Akr1b3 UTSW 6 34310064 missense probably damaging 1.00
R4323:Akr1b3 UTSW 6 34310927 missense probably benign 0.00
R4373:Akr1b3 UTSW 6 34304267 utr 3 prime probably benign
R4606:Akr1b3 UTSW 6 34306664 unclassified probably benign
R5513:Akr1b3 UTSW 6 34316646 intron probably benign
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6560:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6561:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6632:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6654:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6655:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6657:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6658:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6662:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R8209:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAGTGGATCAGACAGTGC -3'
(R):5'- TGTAAACTCTCCAGCCACTCTGAG -3'

Sequencing Primer
(F):5'- CAGTGGATCAGACAGTGCAGGAG -3'
(R):5'- CACTCTGAGCACCGTGGTTATG -3'
Posted On2020-07-13