Incidental Mutation 'R0718:Alms1'
ID 63699
Institutional Source Beutler Lab
Gene Symbol Alms1
Ensembl Gene ENSMUSG00000063810
Gene Name ALMS1, centrosome and basal body associated
Synonyms
MMRRC Submission 038900-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0718 (G1)
Quality Score 182
Status Validated
Chromosome 6
Chromosomal Location 85587531-85702753 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85621821 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1210 (S1210T)
Ref Sequence ENSEMBL: ENSMUSP00000071904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000072018
AA Change: S1210T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: S1210T

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213058
AA Change: S1679T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,679,608 Y811N possibly damaging Het
Adrm1 T C 2: 180,175,147 probably benign Het
Ampd3 C T 7: 110,777,808 P11L probably damaging Het
Arhgap5 A G 12: 52,516,507 E87G possibly damaging Het
Armc5 C T 7: 128,240,070 probably benign Het
Asic2 C G 11: 80,971,456 probably benign Het
Asph A G 4: 9,514,683 probably benign Het
Bicd2 T A 13: 49,377,875 probably null Het
Brip1 A G 11: 86,143,305 L530P possibly damaging Het
Bsn G T 9: 108,111,360 probably benign Het
Btnl4 T A 17: 34,469,634 H390L probably benign Het
Ccdc70 A C 8: 21,973,308 K38T probably damaging Het
Ccni G A 5: 93,202,316 P35S probably benign Het
Cdh17 A G 4: 11,810,451 D714G possibly damaging Het
Cenpf A G 1: 189,653,984 L2033P probably damaging Het
Cfap69 A T 5: 5,621,924 M328K probably damaging Het
Cmah T G 13: 24,417,210 probably null Het
Cog6 T C 3: 53,010,629 T163A probably benign Het
Cyp2j8 G A 4: 96,501,196 S130F probably benign Het
Dgki A G 6: 37,012,896 V636A probably damaging Het
Dmkn T A 7: 30,764,786 probably benign Het
Dnah6 A G 6: 73,035,293 I3679T possibly damaging Het
Dsp A T 13: 38,196,764 Y2495F possibly damaging Het
Exosc4 C T 15: 76,329,489 A171V probably benign Het
Fbxw24 A G 9: 109,623,509 probably benign Het
Flvcr1 A T 1: 191,025,582 L171Q probably damaging Het
Fsd1 G T 17: 55,996,445 probably null Het
Gm7732 A G 17: 21,129,844 noncoding transcript Het
H2-K2 A C 17: 33,975,623 noncoding transcript Het
Hgf A G 5: 16,593,859 N295S probably damaging Het
Ift88 T A 14: 57,517,413 D811E probably benign Het
Igsf9b T A 9: 27,323,361 probably null Het
Immt T A 6: 71,863,172 V311E probably damaging Het
Ipo11 T A 13: 106,919,611 N51I possibly damaging Het
Isy1 T C 6: 87,819,176 K260E probably damaging Het
Jchain T G 5: 88,526,202 I28L probably benign Het
Jmjd1c T A 10: 67,218,946 probably null Het
Kif13b T C 14: 64,751,662 probably benign Het
Klhdc7b T C 15: 89,388,169 Y427H possibly damaging Het
Klhl8 T C 5: 103,876,293 probably benign Het
Lrp2 C T 2: 69,510,948 D963N probably damaging Het
Ltbp3 G T 19: 5,746,748 probably benign Het
Ltf C A 9: 111,040,379 Q41K probably benign Het
Med4 T A 14: 73,516,657 I148N probably damaging Het
Mlh3 T G 12: 85,247,697 S1242R possibly damaging Het
Mllt6 T C 11: 97,676,359 probably benign Het
Mpdz A G 4: 81,292,473 I1712T possibly damaging Het
Mrgprb4 T A 7: 48,198,553 H209L probably benign Het
Nkapl A T 13: 21,468,440 M1K probably null Het
Nmur2 T A 11: 56,029,498 probably benign Het
Nsun2 T A 13: 69,543,697 probably benign Het
Olfr1082 G A 2: 86,594,081 T249I probably benign Het
Olfr1130 A G 2: 87,607,927 I180V probably benign Het
Ovgp1 T C 3: 105,974,830 probably benign Het
Pcdh8 A G 14: 79,770,691 V144A possibly damaging Het
Pcnx3 G A 19: 5,677,728 probably benign Het
Pla2r1 C A 2: 60,479,530 V570L possibly damaging Het
Plxnd1 C A 6: 115,966,638 E1202D possibly damaging Het
Ppp1r37 T C 7: 19,532,254 E529G probably benign Het
Prdm15 A G 16: 97,812,633 F496L possibly damaging Het
Prlhr A T 19: 60,468,005 V41D probably benign Het
Prlhr G T 19: 60,468,059 S23* probably null Het
Prpf4 C T 4: 62,414,540 probably benign Het
Psg26 C T 7: 18,475,235 R416H probably benign Het
Psg26 T C 7: 18,478,287 H381R probably benign Het
Ralgds T G 2: 28,549,116 M717R probably benign Het
Rbms1 T C 2: 60,842,412 N44D probably damaging Het
Rpa1 T C 11: 75,318,401 probably benign Het
Rprd2 T C 3: 95,766,387 N568S probably benign Het
Rptor A G 11: 119,872,376 M929V probably benign Het
Rspo1 T A 4: 125,007,149 C97S possibly damaging Het
Scin C T 12: 40,079,607 G396S probably damaging Het
Scn9a T C 2: 66,547,112 N409D probably damaging Het
Sf3b1 A G 1: 55,019,385 I15T probably damaging Het
Sh3bp2 T C 5: 34,555,495 V149A probably damaging Het
Slc39a12 T A 2: 14,407,426 probably benign Het
Sp9 G T 2: 73,273,827 A242S possibly damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tatdn3 G T 1: 191,052,849 probably benign Het
Tex14 G A 11: 87,499,613 V379I probably benign Het
Tmed6 T C 8: 107,061,724 N197S probably damaging Het
Ttbk2 G A 2: 120,748,575 L689F probably benign Het
Ttbk2 A T 2: 120,745,160 I1043N probably benign Het
Ttn A G 2: 76,810,696 S5283P probably damaging Het
Ube3b C A 5: 114,402,555 S441* probably null Het
Ush2a G A 1: 188,797,830 C3272Y probably damaging Het
Vac14 T A 8: 110,632,477 I95K probably damaging Het
Vangl2 G A 1: 172,006,217 A433V probably damaging Het
Vwa5b1 A T 4: 138,608,824 V153D probably damaging Het
Zfhx3 T A 8: 108,955,650 D3240E unknown Het
Zfp945 A G 17: 22,851,030 C632R probably damaging Het
Zfyve26 G A 12: 79,265,802 probably benign Het
Zyg11b A T 4: 108,242,076 I606N possibly damaging Het
Other mutations in Alms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense probably damaging 1.00
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85628961 missense probably damaging 1.00
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense probably benign 0.05
IGL01670:Alms1 APN 6 85678150 missense probably benign 0.00
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.98
IGL02081:Alms1 APN 6 85620303 missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 critical splice donor site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.03
IGL03199:Alms1 APN 6 85622497 missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85599973 splice site probably benign
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.85
ares UTSW 6 85621275 nonsense probably null
ares2 UTSW 6 85677990 nonsense probably null
butterball UTSW 6 85696771 missense probably damaging 0.99
earthquake UTSW 6 85628735 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
gut_check UTSW 6 85620369 nonsense probably null
portly UTSW 6 85619712 missense probably benign 0.00
replete UTSW 6 85629208 missense possibly damaging 0.87
PIT4468001:Alms1 UTSW 6 85624719 critical splice donor site probably null
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85620253 missense possibly damaging 0.90
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0114:Alms1 UTSW 6 85619803 missense probably benign 0.00
R0153:Alms1 UTSW 6 85641381 missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign
R0525:Alms1 UTSW 6 85587760 missense unknown
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense possibly damaging 0.85
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85622880 missense possibly damaging 0.46
R1715:Alms1 UTSW 6 85629052 nonsense probably null
R1723:Alms1 UTSW 6 85628753 missense probably damaging 1.00
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1758:Alms1 UTSW 6 85628505 missense probably damaging 0.99
R1804:Alms1 UTSW 6 85621275 nonsense probably null
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense probably damaging 1.00
R2280:Alms1 UTSW 6 85677973 missense probably damaging 0.99
R2516:Alms1 UTSW 6 85667963 splice site probably benign
R2519:Alms1 UTSW 6 85667963 splice site probably benign
R2566:Alms1 UTSW 6 85622482 missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 splice site probably benign
R2932:Alms1 UTSW 6 85620562 missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 splice site probably benign
R3404:Alms1 UTSW 6 85667963 splice site probably benign
R3405:Alms1 UTSW 6 85667963 splice site probably benign
R3804:Alms1 UTSW 6 85619647 missense probably damaging 1.00
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.41
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign 0.13
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 splice site probably null
R5310:Alms1 UTSW 6 85615368 missense possibly damaging 0.79
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.04
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.01
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5892:Alms1 UTSW 6 85620903 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6144:Alms1 UTSW 6 85623074 missense probably damaging 0.98
R6258:Alms1 UTSW 6 85628735 nonsense probably null
R6260:Alms1 UTSW 6 85628735 nonsense probably null
R6455:Alms1 UTSW 6 85696657 missense probably damaging 0.99
R6569:Alms1 UTSW 6 85641339 missense probably benign 0.07
R6637:Alms1 UTSW 6 85619734 missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85621098 missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85622661 missense possibly damaging 0.87
R7121:Alms1 UTSW 6 85624622 missense probably damaging 1.00
R7179:Alms1 UTSW 6 85621369 missense probably benign 0.09
R7334:Alms1 UTSW 6 85641450 missense probably damaging 0.99
R7376:Alms1 UTSW 6 85622106 missense probably benign 0.10
R7394:Alms1 UTSW 6 85622223 missense possibly damaging 0.54
R7413:Alms1 UTSW 6 85628306 missense probably benign 0.03
R7511:Alms1 UTSW 6 85609425 missense unknown
R7542:Alms1 UTSW 6 85629362 missense possibly damaging 0.62
R7562:Alms1 UTSW 6 85620412 missense probably damaging 1.00
R7575:Alms1 UTSW 6 85622159 missense possibly damaging 0.49
R7577:Alms1 UTSW 6 85615320 missense probably benign 0.09
R7618:Alms1 UTSW 6 85678417 missense probably benign 0.07
R7653:Alms1 UTSW 6 85620595 missense possibly damaging 0.47
R7672:Alms1 UTSW 6 85615351 missense probably damaging 1.00
R7807:Alms1 UTSW 6 85622976 missense possibly damaging 0.91
R7815:Alms1 UTSW 6 85615358 missense probably benign 0.42
R7849:Alms1 UTSW 6 85621497 missense possibly damaging 0.48
R7944:Alms1 UTSW 6 85641380 missense probably benign 0.03
R7954:Alms1 UTSW 6 85621162 missense probably damaging 0.98
R7971:Alms1 UTSW 6 85628679 missense probably benign
R8048:Alms1 UTSW 6 85641334 missense probably benign 0.13
R8223:Alms1 UTSW 6 85643240 nonsense probably null
R8332:Alms1 UTSW 6 85620579 missense probably benign 0.05
R8374:Alms1 UTSW 6 85608991 missense probably benign 0.41
R8470:Alms1 UTSW 6 85641375 missense probably damaging 0.99
R8755:Alms1 UTSW 6 85621574 missense probably benign 0.01
R8979:Alms1 UTSW 6 85621027 missense probably damaging 0.98
R9044:Alms1 UTSW 6 85696753 missense probably damaging 0.98
R9057:Alms1 UTSW 6 85609832 missense unknown
R9224:Alms1 UTSW 6 85621788 missense possibly damaging 0.69
R9259:Alms1 UTSW 6 85667891 missense possibly damaging 0.94
R9401:Alms1 UTSW 6 85678019 nonsense probably null
R9459:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R9633:Alms1 UTSW 6 85623143 missense probably damaging 0.99
R9716:Alms1 UTSW 6 85601252 missense possibly damaging 0.84
R9730:Alms1 UTSW 6 85629438 missense probably benign 0.00
R9790:Alms1 UTSW 6 85619443 missense probably benign 0.04
R9791:Alms1 UTSW 6 85619443 missense probably benign 0.04
R9802:Alms1 UTSW 6 85629238 missense possibly damaging 0.61
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably damaging 0.96
Z1176:Alms1 UTSW 6 85678418 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGCAGGACCTTCTAGTTCCCACTTC -3'
(R):5'- GCTTGACCAAGACCGCTTGAAAC -3'

Sequencing Primer
(F):5'- ACCTTCTAGTTCCCACTTCCATAAAG -3'
(R):5'- CTCTCTGTGTGAGTAAGAACCAG -3'
Posted On 2013-07-30