Incidental Mutation 'R8226:Scd4'
ID 637015
Institutional Source Beutler Lab
Gene Symbol Scd4
Ensembl Gene ENSMUSG00000050195
Gene Name stearoyl-coenzyme A desaturase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock # R8226 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 44333092-44346743 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44334133 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 55 (D55G)
Ref Sequence ENSEMBL: ENSMUSP00000059860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058856]
AlphaFold Q6T707
Predicted Effect probably benign
Transcript: ENSMUST00000058856
AA Change: D55G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000059860
Gene: ENSMUSG00000050195
AA Change: D55G

DomainStartEndE-ValueType
transmembrane domain 65 87 N/A INTRINSIC
Pfam:FA_desaturase 91 311 7e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.7%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,218,199 N27S probably damaging Het
Abcb1b T A 5: 8,821,390 Y315N probably damaging Het
Acy1 A G 9: 106,437,658 I22T probably damaging Het
Akap11 G A 14: 78,511,209 T1246M Het
Akr1b3 G C 6: 34,311,932 T114R probably damaging Het
Apob G A 12: 8,009,056 V2513I probably benign Het
Arhgap21 C T 2: 20,871,745 D820N probably damaging Het
Arl2 A T 19: 6,137,476 probably null Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp5 C T 9: 75,776,324 P78S probably damaging Het
Cic T C 7: 25,287,788 C1374R probably damaging Het
Dennd5b T C 6: 149,014,248 probably null Het
Dhx36 A G 3: 62,470,570 Y1000H probably benign Het
Dnah14 A G 1: 181,795,545 E3996G possibly damaging Het
Efcab6 T C 15: 83,904,255 Y946C probably benign Het
Egfem1 A G 3: 29,657,255 K328E probably damaging Het
F5 T C 1: 164,194,390 V1478A probably benign Het
Fchsd2 C T 7: 101,282,472 P745L probably damaging Het
Gm15448 A C 7: 3,825,110 L66R Het
Gm9573 T C 17: 35,619,707 probably benign Het
Grb10 G T 11: 11,951,533 L214M probably damaging Het
H6pd A G 4: 149,995,989 V133A probably benign Het
Irak4 T A 15: 94,558,363 L277Q probably damaging Het
Krt78 A T 15: 101,947,045 M777K possibly damaging Het
Lrch4 A G 5: 137,639,735 H93R Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mga A G 2: 119,960,385 I2251V probably benign Het
Mtx3 A G 13: 92,847,707 E164G possibly damaging Het
Nbeal1 A T 1: 60,277,177 K1846N probably damaging Het
Nedd1 T A 10: 92,691,935 M466L probably benign Het
Nr4a3 A T 4: 48,056,588 K380M probably damaging Het
Nup107 T C 10: 117,757,931 K786E probably benign Het
Olfr1024 T C 2: 85,904,203 I284V probably benign Het
Olfr110 A T 17: 37,498,669 Q6L probably benign Het
Olfr560 T C 7: 102,753,743 Y62C probably benign Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Pkhd1l1 A G 15: 44,574,407 N3533D possibly damaging Het
Plpp1 A T 13: 112,866,931 T230S probably benign Het
Plxnc1 A C 10: 94,833,368 D1063E possibly damaging Het
Prokr2 C A 2: 132,374,041 A167S probably damaging Het
Qser1 C T 2: 104,788,725 A491T probably benign Het
Rc3h2 T A 2: 37,376,989 Y1040F possibly damaging Het
Rgl2 C T 17: 33,932,527 L182F possibly damaging Het
Rnf130 T C 11: 50,071,270 V181A probably benign Het
Scn7a T G 2: 66,700,860 I558L possibly damaging Het
Serpinb7 G A 1: 107,448,250 probably null Het
Shtn1 T C 19: 59,003,896 I417V possibly damaging Het
Svs3b T A 2: 164,256,220 E60D possibly damaging Het
Tex14 T C 11: 87,484,759 I116T probably damaging Het
Trak1 C T 9: 121,451,727 T394I probably benign Het
Trhde C T 10: 114,567,228 V497M probably damaging Het
Trpc2 A G 7: 102,088,275 M425V possibly damaging Het
Trpm2 C T 10: 77,947,973 R222Q probably damaging Het
Tuba1b C T 15: 98,931,710 G410S probably benign Het
Usp28 T G 9: 49,015,397 probably null Het
Vps13d T C 4: 145,149,290 Y1555C Het
Wdr17 T A 8: 54,693,120 N106Y possibly damaging Het
Other mutations in Scd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Scd4 APN 19 44344747 missense possibly damaging 0.54
IGL02824:Scd4 APN 19 44341259 missense probably damaging 1.00
crisco UTSW 19 44339071 missense probably benign 0.24
IGL03098:Scd4 UTSW 19 44333492 start codon destroyed possibly damaging 0.92
R0576:Scd4 UTSW 19 44341246 missense probably benign 0.00
R0655:Scd4 UTSW 19 44338968 missense possibly damaging 0.52
R1792:Scd4 UTSW 19 44337574 nonsense probably null
R1925:Scd4 UTSW 19 44341384 missense probably damaging 0.99
R1995:Scd4 UTSW 19 44334178 missense possibly damaging 0.93
R5018:Scd4 UTSW 19 44337609 missense probably benign 0.09
R5815:Scd4 UTSW 19 44337564 missense probably damaging 1.00
R6036:Scd4 UTSW 19 44344792 missense probably damaging 0.98
R6036:Scd4 UTSW 19 44344792 missense probably damaging 0.98
R6264:Scd4 UTSW 19 44338959 nonsense probably null
R6946:Scd4 UTSW 19 44333514 missense probably null 0.82
R7661:Scd4 UTSW 19 44339071 missense probably benign 0.24
R7957:Scd4 UTSW 19 44341248 missense probably benign 0.00
R8112:Scd4 UTSW 19 44337506 missense probably benign 0.00
R9752:Scd4 UTSW 19 44334036 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCTGTATTACAGGAGGACC -3'
(R):5'- CAGAGAGCGGCTACTTTTCAG -3'

Sequencing Primer
(F):5'- GCTGTCCTATGTATCTGCTTTTGAC -3'
(R):5'- GCGGCTACTTTTCAGAATCAGAGTC -3'
Posted On 2020-07-13