Incidental Mutation 'R8226:Shtn1'
ID637016
Institutional Source Beutler Lab
Gene Symbol Shtn1
Ensembl Gene ENSMUSG00000041362
Gene Nameshootin 1
Synonyms4930506M07Rik, shootin1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8226 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location58973358-59076069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59003896 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 417 (I417V)
Ref Sequence ENSEMBL: ENSMUSP00000041378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047511] [ENSMUST00000163821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047511
AA Change: I417V

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041378
Gene: ENSMUSG00000041362
AA Change: I417V

DomainStartEndE-ValueType
coiled coil region 7 59 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
coiled coil region 137 233 N/A INTRINSIC
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163821
AA Change: I417V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126227
Gene: ENSMUSG00000041362
AA Change: I417V

DomainStartEndE-ValueType
internal_repeat_1 59 77 1.42e-6 PROSPERO
low complexity region 120 132 N/A INTRINSIC
internal_repeat_1 207 225 1.42e-6 PROSPERO
coiled coil region 259 353 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.7%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,218,199 N27S probably damaging Het
Abcb1b T A 5: 8,821,390 Y315N probably damaging Het
Acy1 A G 9: 106,437,658 I22T probably damaging Het
Akap11 G A 14: 78,511,209 T1246M Het
Akr1b3 G C 6: 34,311,932 T114R probably damaging Het
Apob G A 12: 8,009,056 V2513I probably benign Het
Arhgap21 C T 2: 20,871,745 D820N probably damaging Het
Arl2 A T 19: 6,137,476 probably null Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp5 C T 9: 75,776,324 P78S probably damaging Het
Cic T C 7: 25,287,788 C1374R probably damaging Het
Dennd5b T C 6: 149,014,248 probably null Het
Dhx36 A G 3: 62,470,570 Y1000H probably benign Het
Dnah14 A G 1: 181,795,545 E3996G possibly damaging Het
Efcab6 T C 15: 83,904,255 Y946C probably benign Het
Egfem1 A G 3: 29,657,255 K328E probably damaging Het
F5 T C 1: 164,194,390 V1478A probably benign Het
Fchsd2 C T 7: 101,282,472 P745L probably damaging Het
Gm15448 A C 7: 3,825,110 L66R Het
Gm9573 T C 17: 35,619,707 probably benign Het
Grb10 G T 11: 11,951,533 L214M probably damaging Het
H6pd A G 4: 149,995,989 V133A probably benign Het
Irak4 T A 15: 94,558,363 L277Q probably damaging Het
Krt78 A T 15: 101,947,045 M777K possibly damaging Het
Lrch4 A G 5: 137,639,735 H93R Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mga A G 2: 119,960,385 I2251V probably benign Het
Mtx3 A G 13: 92,847,707 E164G possibly damaging Het
Nbeal1 A T 1: 60,277,177 K1846N probably damaging Het
Nedd1 T A 10: 92,691,935 M466L probably benign Het
Nr4a3 A T 4: 48,056,588 K380M probably damaging Het
Nup107 T C 10: 117,757,931 K786E probably benign Het
Olfr1024 T C 2: 85,904,203 I284V probably benign Het
Olfr110 A T 17: 37,498,669 Q6L probably benign Het
Olfr560 T C 7: 102,753,743 Y62C probably benign Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Pkhd1l1 A G 15: 44,574,407 N3533D possibly damaging Het
Plpp1 A T 13: 112,866,931 T230S probably benign Het
Plxnc1 A C 10: 94,833,368 D1063E possibly damaging Het
Prokr2 C A 2: 132,374,041 A167S probably damaging Het
Qser1 C T 2: 104,788,725 A491T probably benign Het
Rc3h2 T A 2: 37,376,989 Y1040F possibly damaging Het
Rgl2 C T 17: 33,932,527 L182F possibly damaging Het
Rnf130 T C 11: 50,071,270 V181A probably benign Het
Scd4 A G 19: 44,334,133 D55G probably benign Het
Scn7a T G 2: 66,700,860 I558L possibly damaging Het
Serpinb7 G A 1: 107,448,250 probably null Het
Svs3b T A 2: 164,256,220 E60D possibly damaging Het
Tex14 T C 11: 87,484,759 I116T probably damaging Het
Trak1 C T 9: 121,451,727 T394I probably benign Het
Trhde C T 10: 114,567,228 V497M probably damaging Het
Trpc2 A G 7: 102,088,275 M425V possibly damaging Het
Trpm2 C T 10: 77,947,973 R222Q probably damaging Het
Tuba1b C T 15: 98,931,710 G410S probably benign Het
Usp28 T G 9: 49,015,397 probably null Het
Vps13d T C 4: 145,149,290 Y1555C Het
Wdr17 T A 8: 54,693,120 N106Y possibly damaging Het
Other mutations in Shtn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Shtn1 APN 19 59018952 missense possibly damaging 0.56
IGL01619:Shtn1 APN 19 59028169 missense probably damaging 0.99
IGL01880:Shtn1 APN 19 59075449 splice site probably benign
IGL02214:Shtn1 APN 19 58999886 splice site probably benign
IGL03400:Shtn1 APN 19 59032258 splice site probably benign
R0011:Shtn1 UTSW 19 59032218 missense possibly damaging 0.72
R0011:Shtn1 UTSW 19 59032218 missense possibly damaging 0.72
R0299:Shtn1 UTSW 19 59018951 missense probably benign 0.00
R0606:Shtn1 UTSW 19 58999940 missense probably damaging 0.99
R1081:Shtn1 UTSW 19 58975015 missense probably benign 0.04
R1212:Shtn1 UTSW 19 59050890 missense probably damaging 1.00
R1677:Shtn1 UTSW 19 59009790 missense probably damaging 1.00
R1791:Shtn1 UTSW 19 59032200 missense probably damaging 0.99
R1966:Shtn1 UTSW 19 58975038 missense probably benign
R3076:Shtn1 UTSW 19 58995086 missense probably damaging 1.00
R3552:Shtn1 UTSW 19 58975038 missense probably benign 0.28
R3736:Shtn1 UTSW 19 59022268 missense probably benign
R4615:Shtn1 UTSW 19 59022216 missense probably benign 0.18
R4789:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4791:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4792:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4939:Shtn1 UTSW 19 59022201 missense probably benign 0.00
R5245:Shtn1 UTSW 19 59032220 missense possibly damaging 0.90
R5387:Shtn1 UTSW 19 59038369 missense probably damaging 1.00
R5813:Shtn1 UTSW 19 59032241 missense probably damaging 1.00
R6013:Shtn1 UTSW 19 58975101 missense probably damaging 1.00
R6374:Shtn1 UTSW 19 59038296 missense possibly damaging 0.94
R7030:Shtn1 UTSW 19 59009834 missense possibly damaging 0.74
R7143:Shtn1 UTSW 19 59018906 missense probably damaging 0.99
R7487:Shtn1 UTSW 19 59003860 missense probably damaging 0.99
R7496:Shtn1 UTSW 19 59028184 missense probably damaging 1.00
R7889:Shtn1 UTSW 19 59003896 missense probably damaging 0.99
R8209:Shtn1 UTSW 19 59003896 missense possibly damaging 0.86
R8290:Shtn1 UTSW 19 58999894 missense probably damaging 1.00
R8857:Shtn1 UTSW 19 58990368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCCTGATGTAGCTGTCATC -3'
(R):5'- TATTGGTGTTCTGCCACAGC -3'

Sequencing Primer
(F):5'- AAGGAAACTGATGCCCTCTTCTGG -3'
(R):5'- TGTTCTGCCACAGCCTGAAAAATG -3'
Posted On2020-07-13