Mutagenetix > Incidental Mutation

Incidental Mutation 'R8227:Dusp13b'

637032

Institutional Source

Beutler Lab

Gene Symbol

Dusp13b

Ensembl Gene

ENSMUSG00000021768

Gene Name

dual specificity phosphatase 13B

Synonyms

TS-DSP6, TMDP, Dusp13, LMW-DSP6, LOC382853

MMRRC Submission

067644-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8227 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

21783463-21792947 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21792869 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 19 (S19P)

Ref Sequence

ENSEMBL: ENSMUSP00000113305 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075040] [ENSMUST00000119866] [ENSMUST00000120956] [ENSMUST00000120984] [ENSMUST00000127851] [ENSMUST00000153071] [ENSMUST00000183698] [ENSMUST00000183893] [ENSMUST00000183943] [ENSMUST00000184571] [ENSMUST00000184703] [ENSMUST00000185042]

AlphaFold

Q9QYJ7

Predicted Effect

probably benign
Transcript: ENSMUST00000075040

SMART Domains

Protein: ENSMUSP00000074553
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
DSPc	37	181	7.66e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000119866

SMART Domains

Protein: ENSMUSP00000112552
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
DSPc	45	190	9.29e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120956
AA Change: S19P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113305
Gene: ENSMUSG00000021768
AA Change: S19P

Domain	Start	End	E-Value	Type
DSPc	110	255	9.29e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120984

SMART Domains

Protein: ENSMUSP00000113985
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
DSPc	45	190	9.29e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127851

SMART Domains

Protein: ENSMUSP00000120977
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
SCOP:d1vhra_	20	133	9e-10	SMART
Blast:DSPc	37	129	5e-60	BLAST
PDB:2E0T\|A	39	129	1e-26	PDB
low complexity region	162	173	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153071

SMART Domains

Protein: ENSMUSP00000139140
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
Pfam:DSPc	1	48	5.2e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183698

SMART Domains

Protein: ENSMUSP00000139058
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
DSPc	68	213	9.29e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183893

SMART Domains

Protein: ENSMUSP00000139061
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183943

SMART Domains

Protein: ENSMUSP00000139154
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
internal_repeat_1	19	71	6.78e-8	PROSPERO
DSPc	95	240	9.29e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184571

Predicted Effect

probably benign
Transcript: ENSMUST00000184703

SMART Domains

Protein: ENSMUSP00000138972
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
DSPc	45	190	9.29e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185042

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.3%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In humans, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp7	C	A	7: 28,316,073 (GRCm39)	S171I	probably damaging	Het
Arhgap24	A	G	5: 103,023,647 (GRCm39)	E227G	probably benign	Het
Atp13a4	A	G	16: 29,222,663 (GRCm39)	V1087A		Het
Csnk1g2	G	A	10: 80,474,463 (GRCm39)		probably null	Het
Dlc1	A	G	8: 37,039,825 (GRCm39)	L994S	probably damaging	Het
Foxr1	T	C	9: 44,347,304 (GRCm39)	S78G	probably benign	Het
Gm1968	T	A	16: 29,777,380 (GRCm39)	K93N	noncoding transcript	Het
Gm4781	G	A	10: 100,232,424 (GRCm39)	P171S	noncoding transcript	Het
Gm7276	T	A	18: 77,273,158 (GRCm39)	Q192L	unknown	Het
Greb1l	T	A	18: 10,515,371 (GRCm39)	L721H	probably damaging	Het
Grm3	T	C	5: 9,620,242 (GRCm39)	D334G	possibly damaging	Het
Lama3	C	T	18: 12,540,608 (GRCm39)	A304V	probably benign	Het
Lamc1	G	A	1: 153,099,500 (GRCm39)	S1491L	probably benign	Het
Lepr	T	C	4: 101,628,559 (GRCm39)	S555P	probably damaging	Het
Mup14	C	T	4: 61,258,494 (GRCm39)	E97K	probably benign	Het
Pdss2	A	T	10: 43,221,577 (GRCm39)	H163L	probably damaging	Het
Rps16	T	A	7: 28,051,926 (GRCm39)	D101E	probably benign	Het
Rpusd4	T	C	9: 35,179,831 (GRCm39)	V108A	probably benign	Het
Slc7a14	T	C	3: 31,263,361 (GRCm39)	K727R	probably benign	Het
Snx6	A	T	12: 54,798,756 (GRCm39)	F351I	possibly damaging	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,453,579 (GRCm39)		probably benign	Het
Togaram2	T	A	17: 72,021,237 (GRCm39)	Y675*	probably null	Het

Other mutations in Dusp13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01803:Dusp13b	APN	14	21,783,907 (GRCm39)	missense	probably damaging	1.00
IGL02963:Dusp13b	APN	14	21,783,875 (GRCm39)	missense	possibly damaging	0.86
R0827:Dusp13b	UTSW	14	21,792,839 (GRCm39)	missense	probably benign
R1185:Dusp13b	UTSW	14	21,785,086 (GRCm39)	missense	probably damaging	1.00
R1185:Dusp13b	UTSW	14	21,785,086 (GRCm39)	missense	probably damaging	1.00
R1185:Dusp13b	UTSW	14	21,785,086 (GRCm39)	missense	probably damaging	1.00
R1882:Dusp13b	UTSW	14	21,785,043 (GRCm39)	missense	probably benign	0.04
R2915:Dusp13b	UTSW	14	21,790,205 (GRCm39)	missense	probably damaging	1.00
R3954:Dusp13b	UTSW	14	21,790,175 (GRCm39)	missense	probably damaging	1.00
R4623:Dusp13b	UTSW	14	21,793,546 (GRCm39)	unclassified	probably benign
R4837:Dusp13b	UTSW	14	21,793,593 (GRCm39)	utr 3 prime	probably benign
R6713:Dusp13b	UTSW	14	21,798,541 (GRCm39)	missense	probably damaging	1.00
R7294:Dusp13b	UTSW	14	21,783,782 (GRCm39)	missense	possibly damaging	0.47
R7782:Dusp13b	UTSW	14	21,791,404 (GRCm39)	missense	possibly damaging	0.86
R8088:Dusp13b	UTSW	14	21,791,305 (GRCm39)	missense	probably benign	0.33
R8176:Dusp13b	UTSW	14	21,797,549 (GRCm39)	missense	possibly damaging	0.81
R8520:Dusp13b	UTSW	14	21,793,538 (GRCm39)	nonsense	probably null
R8724:Dusp13b	UTSW	14	21,796,475 (GRCm39)	missense	probably benign	0.04
R8973:Dusp13b	UTSW	14	21,784,974 (GRCm39)	missense	probably benign	0.01
R9031:Dusp13b	UTSW	14	21,790,233 (GRCm39)	missense	probably benign	0.00
R9142:Dusp13b	UTSW	14	21,792,756 (GRCm39)	missense	probably benign	0.30
R9186:Dusp13b	UTSW	14	21,798,563 (GRCm39)	missense	probably damaging	0.97
R9258:Dusp13b	UTSW	14	21,791,155 (GRCm39)	missense	probably benign	0.44
R9630:Dusp13b	UTSW	14	21,784,974 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCCTTCTAGAATACCACCCTGC -3'
(R):5'- CTCATTTATGTGGCACCTGC -3'

Sequencing Primer
(F):5'- ATACCTCGGGCCTTGCTCAG -3'
(R):5'- GTGAAGACTCAGGCTCA -3'

Posted On

2020-07-13