Incidental Mutation 'R8228:0610030E20Rik'
ID 637049
Institutional Source Beutler Lab
Gene Symbol 0610030E20Rik
Ensembl Gene ENSMUSG00000058706
Gene Name RIKEN cDNA 0610030E20 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8228 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 72347317-72353148 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 72347517 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070345] [ENSMUST00000077783]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070345
SMART Domains Protein: ENSMUSP00000064515
Gene: ENSMUSG00000056305

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 48 73 N/A INTRINSIC
ZnF_C2H2 133 154 5.07e0 SMART
Pfam:UCH 223 551 3.9e-45 PFAM
Pfam:UCH_1 224 533 1.3e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000077783
SMART Domains Protein: ENSMUSP00000076957
Gene: ENSMUSG00000058706

DomainStartEndE-ValueType
Pfam:UPF0561 1 126 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206262
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,305 Y158H probably benign Het
4930438A08Rik T A 11: 58,291,555 I252N Het
A930011G23Rik G A 5: 99,377,121 P60S probably damaging Het
Abcf1 A G 17: 35,961,041 probably null Het
AI987944 T C 7: 41,376,836 T14A probably damaging Het
Alox12b T C 11: 69,163,929 Y253H probably damaging Het
Anapc1 T A 2: 128,619,917 K1756* probably null Het
Arid5b T A 10: 68,278,706 E2V possibly damaging Het
Atp13a1 G A 8: 69,798,919 V545M probably damaging Het
Atp2b4 TTCTTC TTCTTCCTCTTC 1: 133,701,721 probably benign Het
Ccdc189 G A 7: 127,585,007 T239M probably benign Het
Col1a1 T G 11: 94,945,600 probably null Het
Col4a3bp A G 13: 96,543,215 T18A probably benign Het
Csdc2 C T 15: 81,949,210 T136I possibly damaging Het
Dpp9 A T 17: 56,191,129 I609N probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG,TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Gjb6 T C 14: 57,124,469 R112G probably benign Het
Gm19410 A G 8: 35,785,838 K646E possibly damaging Het
Grik5 T C 7: 25,010,508 E934G probably damaging Het
Grik5 A T 7: 25,046,310 F446Y possibly damaging Het
Iffo2 C G 4: 139,575,172 N75K probably damaging Het
Kif15 A G 9: 122,991,976 N649D possibly damaging Het
Lrit2 G A 14: 37,069,191 A276T probably damaging Het
Mcm8 T C 2: 132,842,794 probably null Het
Mut A G 17: 40,937,328 E82G possibly damaging Het
Olfr1151 T A 2: 87,857,940 M255K probably benign Het
Olfr732 A G 14: 50,281,540 S238P probably damaging Het
Pcdhga8 A G 18: 37,728,183 Q764R probably benign Het
Pcgf2 T C 11: 97,692,039 Y138C probably benign Het
Phf20l1 G T 15: 66,639,940 V922F possibly damaging Het
Pkd1l2 A T 8: 117,065,775 I426N probably damaging Het
Psmd6 T C 14: 14,116,843 N160S possibly damaging Het
Robo1 A G 16: 73,012,880 D1172G probably benign Het
Sdr9c7 T C 10: 127,898,675 Y11H possibly damaging Het
Sec24c G T 14: 20,689,907 A635S probably benign Het
Tex2 T C 11: 106,567,171 I478V probably benign Het
Traip T C 9: 107,961,066 M166T probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Trim46 G T 3: 89,234,948 T744N probably benign Het
Tsc1 C A 2: 28,676,129 A520D probably benign Het
Usp36 T C 11: 118,264,890 E852G possibly damaging Het
Vmn2r101 C T 17: 19,591,022 T456I probably benign Het
Zc3h7a A G 16: 11,139,090 F885S probably damaging Het
Zfp335 G A 2: 164,904,898 R354W probably damaging Het
Zfp456 C A 13: 67,366,414 C391F probably damaging Het
Other mutations in 0610030E20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5664:0610030E20Rik UTSW 6 72348994 splice site probably null
R6170:0610030E20Rik UTSW 6 72348572 missense probably benign 0.00
R6284:0610030E20Rik UTSW 6 72347454 missense probably damaging 1.00
R7988:0610030E20Rik UTSW 6 72347652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCTCAAATTTCGAAAGCATCTC -3'
(R):5'- ACACTTGTAGGTCTGGCTTG -3'

Sequencing Primer
(F):5'- AAGTCATGGTCCGCAGC -3'
(R):5'- AGGTCTGGCTTGCGGGG -3'
Posted On 2020-07-13