Incidental Mutation 'R8228:0610030E20Rik'
List |< first << previous [record 58 of 510414] next >> last >|
ID637049
Institutional Source Beutler Lab
Gene Symbol 0610030E20Rik
Ensembl Gene ENSMUSG00000058706
Gene NameRIKEN cDNA 0610030E20 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8228 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location72347317-72353148 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 72347517 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070345] [ENSMUST00000077783]
Predicted Effect probably benign
Transcript: ENSMUST00000070345
SMART Domains Protein: ENSMUSP00000064515
Gene: ENSMUSG00000056305

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 48 73 N/A INTRINSIC
ZnF_C2H2 133 154 5.07e0 SMART
Pfam:UCH 223 551 3.9e-45 PFAM
Pfam:UCH_1 224 533 1.3e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000077783
SMART Domains Protein: ENSMUSP00000076957
Gene: ENSMUSG00000058706

DomainStartEndE-ValueType
Pfam:UPF0561 1 126 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206262
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,305 Y158H probably benign Het
4930438A08Rik T A 11: 58,291,555 I252N Het
A930011G23Rik G A 5: 99,377,121 P60S probably damaging Het
Abcf1 A G 17: 35,961,041 probably null Het
AI987944 T C 7: 41,376,836 T14A probably damaging Het
Alox12b T C 11: 69,163,929 Y253H probably damaging Het
Anapc1 T A 2: 128,619,917 K1756* probably null Het
Arid5b T A 10: 68,278,706 E2V possibly damaging Het
Atp13a1 G A 8: 69,798,919 V545M probably damaging Het
Atp2b4 TTCTTC TTCTTCCTCTTC 1: 133,701,721 probably benign Het
Ccdc189 G A 7: 127,585,007 T239M probably benign Het
Col1a1 T G 11: 94,945,600 probably null Het
Col4a3bp A G 13: 96,543,215 T18A probably benign Het
Csdc2 C T 15: 81,949,210 T136I possibly damaging Het
Dpp9 A T 17: 56,191,129 I609N probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG,TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Gjb6 T C 14: 57,124,469 R112G probably benign Het
Gm19410 A G 8: 35,785,838 K646E possibly damaging Het
Grik5 T C 7: 25,010,508 E934G probably damaging Het
Grik5 A T 7: 25,046,310 F446Y possibly damaging Het
Iffo2 C G 4: 139,575,172 N75K probably damaging Het
Kif15 A G 9: 122,991,976 N649D possibly damaging Het
Lrit2 G A 14: 37,069,191 A276T probably damaging Het
Mcm8 T C 2: 132,842,794 probably null Het
Mut A G 17: 40,937,328 E82G possibly damaging Het
Olfr1151 T A 2: 87,857,940 M255K probably benign Het
Olfr732 A G 14: 50,281,540 S238P probably damaging Het
Pcdhga8 A G 18: 37,728,183 Q764R probably benign Het
Pcgf2 T C 11: 97,692,039 Y138C probably benign Het
Phf20l1 G T 15: 66,639,940 V922F possibly damaging Het
Pkd1l2 A T 8: 117,065,775 I426N probably damaging Het
Psmd6 T C 14: 14,116,843 N160S possibly damaging Het
Robo1 A G 16: 73,012,880 D1172G probably benign Het
Sdr9c7 T C 10: 127,898,675 Y11H possibly damaging Het
Sec24c G T 14: 20,689,907 A635S probably benign Het
Tex2 T C 11: 106,567,171 I478V probably benign Het
Traip T C 9: 107,961,066 M166T probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Trim46 G T 3: 89,234,948 T744N probably benign Het
Tsc1 C A 2: 28,676,129 A520D probably benign Het
Usp36 T C 11: 118,264,890 E852G possibly damaging Het
Vmn2r101 C T 17: 19,591,022 T456I probably benign Het
Zc3h7a A G 16: 11,139,090 F885S probably damaging Het
Zfp335 G A 2: 164,904,898 R354W probably damaging Het
Zfp456 C A 13: 67,366,414 C391F probably damaging Het
Other mutations in 0610030E20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5664:0610030E20Rik UTSW 6 72348994 splice site probably null
R6170:0610030E20Rik UTSW 6 72348572 missense probably benign 0.00
R6284:0610030E20Rik UTSW 6 72347454 missense probably damaging 1.00
R7988:0610030E20Rik UTSW 6 72347652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCTCAAATTTCGAAAGCATCTC -3'
(R):5'- ACACTTGTAGGTCTGGCTTG -3'

Sequencing Primer
(F):5'- AAGTCATGGTCCGCAGC -3'
(R):5'- AGGTCTGGCTTGCGGGG -3'
Posted On2020-07-13