Incidental Mutation 'R8228:Kif15'
ID637059
Institutional Source Beutler Lab
Gene Symbol Kif15
Ensembl Gene ENSMUSG00000036768
Gene Namekinesin family member 15
SynonymsHKLP2, Knsl7, N-10 kinesin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8228 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location122951046-123018733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122991976 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 649 (N649D)
Ref Sequence ENSEMBL: ENSMUSP00000035490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040717]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040717
AA Change: N649D

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035490
Gene: ENSMUSG00000036768
AA Change: N649D

DomainStartEndE-ValueType
KISc 24 371 2.86e-179 SMART
Pfam:Kinesin-relat_1 463 551 6.6e-26 PFAM
coiled coil region 579 643 N/A INTRINSIC
coiled coil region 706 1037 N/A INTRINSIC
coiled coil region 1065 1133 N/A INTRINSIC
Pfam:HMMR_C 1265 1387 3.5e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T C 6: 72,347,517 probably null Het
1700008O03Rik A G 7: 44,360,305 Y158H probably benign Het
4930438A08Rik T A 11: 58,291,555 I252N Het
A930011G23Rik G A 5: 99,377,121 P60S probably damaging Het
Abcf1 A G 17: 35,961,041 probably null Het
AI987944 T C 7: 41,376,836 T14A probably damaging Het
Alox12b T C 11: 69,163,929 Y253H probably damaging Het
Anapc1 T A 2: 128,619,917 K1756* probably null Het
Arid5b T A 10: 68,278,706 E2V possibly damaging Het
Atp13a1 G A 8: 69,798,919 V545M probably damaging Het
Atp2b4 TTCTTC TTCTTCCTCTTC 1: 133,701,721 probably benign Het
Ccdc189 G A 7: 127,585,007 T239M probably benign Het
Col1a1 T G 11: 94,945,600 probably null Het
Col4a3bp A G 13: 96,543,215 T18A probably benign Het
Csdc2 C T 15: 81,949,210 T136I possibly damaging Het
Dpp9 A T 17: 56,191,129 I609N probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG,TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Gjb6 T C 14: 57,124,469 R112G probably benign Het
Gm19410 A G 8: 35,785,838 K646E possibly damaging Het
Grik5 T C 7: 25,010,508 E934G probably damaging Het
Grik5 A T 7: 25,046,310 F446Y possibly damaging Het
Iffo2 C G 4: 139,575,172 N75K probably damaging Het
Lrit2 G A 14: 37,069,191 A276T probably damaging Het
Mcm8 T C 2: 132,842,794 probably null Het
Mut A G 17: 40,937,328 E82G possibly damaging Het
Olfr1151 T A 2: 87,857,940 M255K probably benign Het
Olfr732 A G 14: 50,281,540 S238P probably damaging Het
Pcdhga8 A G 18: 37,728,183 Q764R probably benign Het
Pcgf2 T C 11: 97,692,039 Y138C probably benign Het
Phf20l1 G T 15: 66,639,940 V922F possibly damaging Het
Pkd1l2 A T 8: 117,065,775 I426N probably damaging Het
Psmd6 T C 14: 14,116,843 N160S possibly damaging Het
Robo1 A G 16: 73,012,880 D1172G probably benign Het
Sdr9c7 T C 10: 127,898,675 Y11H possibly damaging Het
Sec24c G T 14: 20,689,907 A635S probably benign Het
Tex2 T C 11: 106,567,171 I478V probably benign Het
Traip T C 9: 107,961,066 M166T probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Trim46 G T 3: 89,234,948 T744N probably benign Het
Tsc1 C A 2: 28,676,129 A520D probably benign Het
Usp36 T C 11: 118,264,890 E852G possibly damaging Het
Vmn2r101 C T 17: 19,591,022 T456I probably benign Het
Zc3h7a A G 16: 11,139,090 F885S probably damaging Het
Zfp335 G A 2: 164,904,898 R354W probably damaging Het
Zfp456 C A 13: 67,366,414 C391F probably damaging Het
Other mutations in Kif15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Kif15 APN 9 122975755 missense probably damaging 1.00
IGL01577:Kif15 APN 9 122996334 missense probably benign 0.06
IGL01647:Kif15 APN 9 122963471 intron probably benign
IGL01921:Kif15 APN 9 122979504 missense probably damaging 1.00
IGL02040:Kif15 APN 9 123017385 missense probably damaging 0.99
IGL02191:Kif15 APN 9 122975679 missense probably damaging 1.00
IGL02218:Kif15 APN 9 122995827 splice site probably benign
IGL02537:Kif15 APN 9 122993849 missense probably benign 0.08
IGL02814:Kif15 APN 9 123003640 missense possibly damaging 0.83
PIT4480001:Kif15 UTSW 9 123011543 missense probably benign
R0034:Kif15 UTSW 9 122999285 missense possibly damaging 0.47
R0458:Kif15 UTSW 9 123009359 missense probably benign
R0526:Kif15 UTSW 9 122997797 missense probably damaging 0.96
R0533:Kif15 UTSW 9 123009433 unclassified probably benign
R0726:Kif15 UTSW 9 122959928 missense probably benign 0.21
R1580:Kif15 UTSW 9 122959956 missense probably benign 0.22
R1597:Kif15 UTSW 9 122994009 missense probably benign 0.22
R2096:Kif15 UTSW 9 122986187 missense probably damaging 1.00
R3125:Kif15 UTSW 9 122987961 missense probably damaging 0.99
R3176:Kif15 UTSW 9 122987840 splice site probably benign
R4088:Kif15 UTSW 9 122986189 missense probably benign 0.29
R4308:Kif15 UTSW 9 123013982 missense probably benign 0.00
R4597:Kif15 UTSW 9 122993849 missense probably benign 0.08
R4705:Kif15 UTSW 9 122959993 splice site probably null
R4832:Kif15 UTSW 9 123002126 splice site probably null
R5100:Kif15 UTSW 9 122991994 missense probably damaging 0.98
R5126:Kif15 UTSW 9 122975758 missense probably damaging 1.00
R5180:Kif15 UTSW 9 122999210 missense probably damaging 0.99
R5247:Kif15 UTSW 9 122986442 missense possibly damaging 0.65
R5376:Kif15 UTSW 9 122993971 missense probably benign 0.04
R5392:Kif15 UTSW 9 122996295 missense probably damaging 0.99
R5422:Kif15 UTSW 9 122984889 splice site probably null
R5562:Kif15 UTSW 9 122978016 missense probably damaging 1.00
R5663:Kif15 UTSW 9 122991851 splice site probably null
R5767:Kif15 UTSW 9 123013974 missense possibly damaging 0.78
R5927:Kif15 UTSW 9 123017261 missense probably benign 0.00
R6049:Kif15 UTSW 9 123011622 missense probably damaging 0.98
R6435:Kif15 UTSW 9 122986491 missense probably damaging 1.00
R7040:Kif15 UTSW 9 123011614 missense possibly damaging 0.67
R7158:Kif15 UTSW 9 122999314 missense probably benign
R7163:Kif15 UTSW 9 123017657 missense probably damaging 1.00
R7197:Kif15 UTSW 9 123009926 critical splice donor site probably null
R7318:Kif15 UTSW 9 122987949 missense probably damaging 1.00
R7360:Kif15 UTSW 9 122991137 missense probably benign
R8039:Kif15 UTSW 9 123007425 missense possibly damaging 0.82
Z1177:Kif15 UTSW 9 122951051 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAAATCACATGTGAGCATAAACTG -3'
(R):5'- AGCACTGTCTAAAGTTCATGACG -3'

Sequencing Primer
(F):5'- TCACATGTGAGCATAAACTGTAATG -3'
(R):5'- TCATGACGAAACAGAATTTGATCCC -3'
Posted On2020-07-13