Incidental Mutation 'R8228:Usp36'
ID637068
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Nameubiquitin specific peptidase 36
Synonyms2700002L06Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R8228 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location118259651-118290244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118264890 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 852 (E852G)
Ref Sequence ENSEMBL: ENSMUSP00000090036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092382
AA Change: E852G

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: E852G

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106296
AA Change: E852G

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: E852G

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144153
AA Change: E687G

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: E687G

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T C 6: 72,347,517 probably null Het
1700008O03Rik A G 7: 44,360,305 Y158H probably benign Het
4930438A08Rik T A 11: 58,291,555 I252N Het
A930011G23Rik G A 5: 99,377,121 P60S probably damaging Het
Abcf1 A G 17: 35,961,041 probably null Het
AI987944 T C 7: 41,376,836 T14A probably damaging Het
Alox12b T C 11: 69,163,929 Y253H probably damaging Het
Anapc1 T A 2: 128,619,917 K1756* probably null Het
Arid5b T A 10: 68,278,706 E2V possibly damaging Het
Atp13a1 G A 8: 69,798,919 V545M probably damaging Het
Atp2b4 TTCTTC TTCTTCCTCTTC 1: 133,701,721 probably benign Het
Ccdc189 G A 7: 127,585,007 T239M probably benign Het
Col1a1 T G 11: 94,945,600 probably null Het
Col4a3bp A G 13: 96,543,215 T18A probably benign Het
Csdc2 C T 15: 81,949,210 T136I possibly damaging Het
Dpp9 A T 17: 56,191,129 I609N probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG,TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Gjb6 T C 14: 57,124,469 R112G probably benign Het
Gm19410 A G 8: 35,785,838 K646E possibly damaging Het
Grik5 A T 7: 25,046,310 F446Y possibly damaging Het
Grik5 T C 7: 25,010,508 E934G probably damaging Het
Iffo2 C G 4: 139,575,172 N75K probably damaging Het
Kif15 A G 9: 122,991,976 N649D possibly damaging Het
Lrit2 G A 14: 37,069,191 A276T probably damaging Het
Mcm8 T C 2: 132,842,794 probably null Het
Mut A G 17: 40,937,328 E82G possibly damaging Het
Olfr1151 T A 2: 87,857,940 M255K probably benign Het
Olfr732 A G 14: 50,281,540 S238P probably damaging Het
Pcdhga8 A G 18: 37,728,183 Q764R probably benign Het
Pcgf2 T C 11: 97,692,039 Y138C probably benign Het
Phf20l1 G T 15: 66,639,940 V922F possibly damaging Het
Pkd1l2 A T 8: 117,065,775 I426N probably damaging Het
Psmd6 T C 14: 14,116,843 N160S possibly damaging Het
Robo1 A G 16: 73,012,880 D1172G probably benign Het
Sdr9c7 T C 10: 127,898,675 Y11H possibly damaging Het
Sec24c G T 14: 20,689,907 A635S probably benign Het
Tex2 T C 11: 106,567,171 I478V probably benign Het
Traip T C 9: 107,961,066 M166T probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Trim46 G T 3: 89,234,948 T744N probably benign Het
Tsc1 C A 2: 28,676,129 A520D probably benign Het
Vmn2r101 C T 17: 19,591,022 T456I probably benign Het
Zc3h7a A G 16: 11,139,090 F885S probably damaging Het
Zfp335 G A 2: 164,904,898 R354W probably damaging Het
Zfp456 C A 13: 67,366,414 C391F probably damaging Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118264820 missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118285960 missense probably damaging 1.00
IGL01720:Usp36 APN 11 118275002 missense probably damaging 0.99
IGL02410:Usp36 APN 11 118276185 missense probably damaging 1.00
IGL02700:Usp36 APN 11 118276157 missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118264783 missense probably benign 0.22
IGL03145:Usp36 APN 11 118279241 missense probably damaging 1.00
IGL03203:Usp36 APN 11 118285810 missense probably benign 0.42
IGL03265:Usp36 APN 11 118264809 missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118265194 missense probably benign 0.21
R0499:Usp36 UTSW 11 118273571 missense probably damaging 0.98
R0606:Usp36 UTSW 11 118263028 splice site probably benign
R0646:Usp36 UTSW 11 118273021 missense probably damaging 1.00
R1579:Usp36 UTSW 11 118284945 missense probably damaging 1.00
R1646:Usp36 UTSW 11 118273566 missense probably damaging 1.00
R1716:Usp36 UTSW 11 118272131 critical splice donor site probably null
R1886:Usp36 UTSW 11 118272958 missense probably damaging 1.00
R2014:Usp36 UTSW 11 118262508 splice site probably benign
R2068:Usp36 UTSW 11 118275018 missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118268665 missense probably benign 0.02
R2191:Usp36 UTSW 11 118285023 missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118276756 splice site probably benign
R3176:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3177:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3276:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3277:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3615:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3616:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3768:Usp36 UTSW 11 118263052 missense probably damaging 1.00
R3899:Usp36 UTSW 11 118279824 missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118279824 missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118285795 missense probably damaging 0.99
R4809:Usp36 UTSW 11 118263070 missense probably damaging 1.00
R5135:Usp36 UTSW 11 118264905 missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118265194 missense probably benign 0.21
R6226:Usp36 UTSW 11 118277274 missense probably damaging 1.00
R6266:Usp36 UTSW 11 118268585 missense probably damaging 1.00
R7191:Usp36 UTSW 11 118268834 missense probably benign 0.39
R7215:Usp36 UTSW 11 118265154 missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118273529 missense probably damaging 1.00
R7535:Usp36 UTSW 11 118262046 missense possibly damaging 0.92
R7675:Usp36 UTSW 11 118263696 missense probably benign 0.11
R7843:Usp36 UTSW 11 118285965 missense probably damaging 1.00
X0020:Usp36 UTSW 11 118273613 missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118276200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGCTGAATTAGGTCCTG -3'
(R):5'- GGACACTTCACGTCCCACTTAC -3'

Sequencing Primer
(F):5'- CTGAATTAGGTCCTGCGACG -3'
(R):5'- CTTACACCAACTGCCAGAGG -3'
Posted On2020-07-13