Mutagenetix > Incidental Mutation

Incidental Mutation 'R8230:Tbx15'

637094

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R8230 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 99351989 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 392 (C392F)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

probably damaging
Transcript: ENSMUST00000029462
AA Change: C392F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: C392F

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaas	A	G	15: 102,338,469	Y485H	probably benign	Het
Actl7a	T	A	4: 56,743,768	H98Q	probably damaging	Het
Adam15	G	A	3: 89,345,610	T267I	probably benign	Het
Ankrd17	T	C	5: 90,243,976	H1945R	possibly damaging	Het
Baiap3	A	G	17: 25,246,853	I585T	probably benign	Het
Bcl6	T	C	16: 23,972,902	D234G	probably damaging	Het
Cbx3	T	C	6: 51,475,301	V32A	probably damaging	Het
Ccdc127	T	C	13: 74,360,632	F50S	unknown	Het
Ccdc15	T	C	9: 37,315,259	E473G	probably benign	Het
Clasp2	A	G	9: 113,892,414	D763G	possibly damaging	Het
Dab2	T	A	15: 6,422,343	F147I	probably damaging	Het
Etv1	T	C	12: 38,780,936	M1T	probably null	Het
F2r	T	A	13: 95,604,739	D96V	possibly damaging	Het
Fancm	A	G	12: 65,102,650	D730G	probably benign	Het
Fbf1	T	C	11: 116,146,739	I892V	probably benign	Het
Gbp8	T	C	5: 105,050,869	N60S	probably benign	Het
Gm12790	T	C	4: 101,968,083	I45V	probably benign	Het
Herc1	G	A	9: 66,470,316	V3455I	probably damaging	Het
Hic1	T	C	11: 75,165,585	D826G	possibly damaging	Het
Hmcn2	A	G	2: 31,344,473	Y300C	possibly damaging	Het
Ifit1	A	G	19: 34,647,668	Q68R	probably benign	Het
Igdcc4	A	G	9: 65,122,738	Y309C	probably damaging	Het
Itpr3	T	C	17: 27,107,737		probably null	Het
Kat7	T	C	11: 95,277,589	K414E	probably damaging	Het
Lmnb2	A	T	10: 80,905,148	L260Q	probably damaging	Het
Mapk1	T	C	16: 17,026,066	I215T	noncoding transcript	Het
Ntpcr	G	T	8: 125,737,420		probably null	Het
Ntrk3	C	A	7: 78,250,770	C607F	probably damaging	Het
Olfr1116	A	T	2: 87,269,201	H119L	probably benign	Het
Olfr1136	T	A	2: 87,693,361	I174F	probably damaging	Het
Olfr684	A	G	7: 105,157,424	I86T	probably damaging	Het
Pcdh15	T	C	10: 74,355,875	V601A	probably damaging	Het
Plagl2	A	G	2: 153,232,319	C221R	probably damaging	Het
Shf	A	G	2: 122,349,487	Y195H	probably damaging	Het
Tapbpl	T	A	6: 125,226,721	Y332F	probably damaging	Het
Ubxn7	T	C	16: 32,375,276	L222P	probably benign	Het
Vprbp	G	A	9: 106,858,715	G954D	probably damaging	Het
Vsig8	A	T	1: 172,561,511	D222V	probably damaging	Het
Xirp2	A	G	2: 67,515,665	E2750G	probably damaging	Het
Zfp870	A	G	17: 32,883,689	V222A	possibly damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTTGCCTTAGACAGACTCATC -3'
(R):5'- AGGCTTCCATCTTGCTGTTG -3'

Sequencing Primer
(F):5'- TGCCTTAGACAGACTCATCTTAATC -3'
(R):5'- TTGCTGGGCAACGAGGG -3'

Posted On

2020-07-13