Mutagenetix > Incidental Mutations

Incidental Mutation 'R8230:Ntpcr'

637103

Institutional Source

Beutler Lab

Gene Symbol

Ntpcr

Ensembl Gene

ENSMUSG00000031851

Gene Name

nucleoside-triphosphatase, cancer-related

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R8230 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

125729963-125748235 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 125737420 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034313] [ENSMUST00000034313] [ENSMUST00000065135] [ENSMUST00000065135] [ENSMUST00000143504] [ENSMUST00000152189] [ENSMUST00000152189]

Predicted Effect

probably null
Transcript: ENSMUST00000034313

SMART Domains

Protein: ENSMUSP00000034313
Gene: ENSMUSG00000031851

Domain	Start	End	E-Value	Type
AAA	1	170	2.61e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000034313

SMART Domains

Protein: ENSMUSP00000034313
Gene: ENSMUSG00000031851

Domain	Start	End	E-Value	Type
AAA	1	170	2.61e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000065135

SMART Domains

Protein: ENSMUSP00000069384
Gene: ENSMUSG00000031851

Domain	Start	End	E-Value	Type
Pfam:NTPase_1	4	107	1.4e-40	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000065135

SMART Domains

Protein: ENSMUSP00000069384
Gene: ENSMUSG00000031851

Domain	Start	End	E-Value	Type
Pfam:NTPase_1	4	107	1.4e-40	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000143504

SMART Domains

Protein: ENSMUSP00000121271
Gene: ENSMUSG00000031851

Domain	Start	End	E-Value	Type
Pfam:NTPase_1	56	145	5.4e-27	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000152189

SMART Domains

Protein: ENSMUSP00000115996
Gene: ENSMUSG00000031851

Domain	Start	End	E-Value	Type
Pfam:NTPase_1	6	178	3.2e-63	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000152189

SMART Domains

Protein: ENSMUSP00000115996
Gene: ENSMUSG00000031851

Domain	Start	End	E-Value	Type
Pfam:NTPase_1	6	178	3.2e-63	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a non-specific nucleoside triphosphatase that is slow-acting in vitro. This gene is overexpressed in many tumor tissues, and while it is not essential for the cell, overexpression is cytotoxic. However, the cytotoxicity is not related to its triphosphatase activity. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaas	A	G	15: 102,338,469	Y485H	probably benign	Het
Actl7a	T	A	4: 56,743,768	H98Q	probably damaging	Het
Adam15	G	A	3: 89,345,610	T267I	probably benign	Het
Ankrd17	T	C	5: 90,243,976	H1945R	possibly damaging	Het
Baiap3	A	G	17: 25,246,853	I585T	probably benign	Het
Bcl6	T	C	16: 23,972,902	D234G	probably damaging	Het
Cbx3	T	C	6: 51,475,301	V32A	probably damaging	Het
Ccdc127	T	C	13: 74,360,632	F50S	unknown	Het
Ccdc15	T	C	9: 37,315,259	E473G	probably benign	Het
Clasp2	A	G	9: 113,892,414	D763G	possibly damaging	Het
Dab2	T	A	15: 6,422,343	F147I	probably damaging	Het
Etv1	T	C	12: 38,780,936	M1T	probably null	Het
F2r	T	A	13: 95,604,739	D96V	possibly damaging	Het
Fancm	A	G	12: 65,102,650	D730G	probably benign	Het
Fbf1	T	C	11: 116,146,739	I892V	probably benign	Het
Gbp8	T	C	5: 105,050,869	N60S	probably benign	Het
Gm12790	T	C	4: 101,968,083	I45V	probably benign	Het
Herc1	G	A	9: 66,470,316	V3455I	probably damaging	Het
Hic1	T	C	11: 75,165,585	D826G	possibly damaging	Het
Hmcn2	A	G	2: 31,344,473	Y300C	possibly damaging	Het
Ifit1	A	G	19: 34,647,668	Q68R	probably benign	Het
Igdcc4	A	G	9: 65,122,738	Y309C	probably damaging	Het
Itpr3	T	C	17: 27,107,737		probably null	Het
Kat7	T	C	11: 95,277,589	K414E	probably damaging	Het
Lmnb2	A	T	10: 80,905,148	L260Q	probably damaging	Het
Mapk1	T	C	16: 17,026,066	I215T	noncoding transcript	Het
Ntrk3	C	A	7: 78,250,770	C607F	probably damaging	Het
Olfr1116	A	T	2: 87,269,201	H119L	probably benign	Het
Olfr1136	T	A	2: 87,693,361	I174F	probably damaging	Het
Olfr684	A	G	7: 105,157,424	I86T	probably damaging	Het
Pcdh15	T	C	10: 74,355,875	V601A	probably damaging	Het
Plagl2	A	G	2: 153,232,319	C221R	probably damaging	Het
Shf	A	G	2: 122,349,487	Y195H	probably damaging	Het
Tapbpl	T	A	6: 125,226,721	Y332F	probably damaging	Het
Tbx15	G	T	3: 99,351,989	C392F	probably damaging	Het
Ubxn7	T	C	16: 32,375,276	L222P	probably benign	Het
Vprbp	G	A	9: 106,858,715	G954D	probably damaging	Het
Vsig8	A	T	1: 172,561,511	D222V	probably damaging	Het
Xirp2	A	G	2: 67,515,665	E2750G	probably damaging	Het
Zfp870	A	G	17: 32,883,689	V222A	possibly damaging	Het

Other mutations in Ntpcr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00971:Ntpcr	APN	8	125747762	missense	probably damaging	0.98
IGL01582:Ntpcr	APN	8	125745242	missense	probably benign	0.11
IGL01862:Ntpcr	APN	8	125736098	missense	probably benign	0.14
IGL02045:Ntpcr	APN	8	125745452	splice site	probably benign
IGL02077:Ntpcr	APN	8	125737368	nonsense	probably null
R0491:Ntpcr	UTSW	8	125737354	nonsense	probably null
R0988:Ntpcr	UTSW	8	125737431	splice site	probably benign
R1781:Ntpcr	UTSW	8	125745402	missense	probably damaging	1.00
R2412:Ntpcr	UTSW	8	125745405	missense	probably damaging	1.00
R3838:Ntpcr	UTSW	8	125737372	missense	probably damaging	1.00
R4453:Ntpcr	UTSW	8	125736190	missense	probably benign	0.14
R6126:Ntpcr	UTSW	8	125735887	critical splice donor site	probably null
R6440:Ntpcr	UTSW	8	125745242	missense	probably damaging	0.97
R6463:Ntpcr	UTSW	8	125736104	missense	probably benign	0.02
R7102:Ntpcr	UTSW	8	125730055	missense	unknown
R7910:Ntpcr	UTSW	8	125747744	missense	probably benign
X0024:Ntpcr	UTSW	8	125745426	missense	probably damaging	0.99
X0025:Ntpcr	UTSW	8	125745315	missense	probably damaging	1.00
Z1177:Ntpcr	UTSW	8	125745284	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGTCCAACCTTGTACACTC -3'
(R):5'- CTCAGGGCAACAGTCAATTGG -3'

Sequencing Primer
(F):5'- GTACACTCTCTCCTTTTATATGGGG -3'
(R):5'- ATTGGACTGCCTATCCTTAGCAAGG -3'

Posted On

2020-07-13