Incidental Mutation 'R8230:Ntpcr'
ID637103
Institutional Source Beutler Lab
Gene Symbol Ntpcr
Ensembl Gene ENSMUSG00000031851
Gene Namenucleoside-triphosphatase, cancer-related
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R8230 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location125729963-125748235 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 125737420 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034313] [ENSMUST00000034313] [ENSMUST00000065135] [ENSMUST00000065135] [ENSMUST00000143504] [ENSMUST00000152189] [ENSMUST00000152189]
Predicted Effect probably null
Transcript: ENSMUST00000034313
SMART Domains Protein: ENSMUSP00000034313
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
AAA 1 170 2.61e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000034313
SMART Domains Protein: ENSMUSP00000034313
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
AAA 1 170 2.61e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065135
SMART Domains Protein: ENSMUSP00000069384
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
Pfam:NTPase_1 4 107 1.4e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065135
SMART Domains Protein: ENSMUSP00000069384
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
Pfam:NTPase_1 4 107 1.4e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143504
SMART Domains Protein: ENSMUSP00000121271
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
Pfam:NTPase_1 56 145 5.4e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152189
SMART Domains Protein: ENSMUSP00000115996
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
Pfam:NTPase_1 6 178 3.2e-63 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152189
SMART Domains Protein: ENSMUSP00000115996
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
Pfam:NTPase_1 6 178 3.2e-63 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a non-specific nucleoside triphosphatase that is slow-acting in vitro. This gene is overexpressed in many tumor tissues, and while it is not essential for the cell, overexpression is cytotoxic. However, the cytotoxicity is not related to its triphosphatase activity. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A G 15: 102,338,469 Y485H probably benign Het
Actl7a T A 4: 56,743,768 H98Q probably damaging Het
Adam15 G A 3: 89,345,610 T267I probably benign Het
Ankrd17 T C 5: 90,243,976 H1945R possibly damaging Het
Baiap3 A G 17: 25,246,853 I585T probably benign Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Cbx3 T C 6: 51,475,301 V32A probably damaging Het
Ccdc127 T C 13: 74,360,632 F50S unknown Het
Ccdc15 T C 9: 37,315,259 E473G probably benign Het
Clasp2 A G 9: 113,892,414 D763G possibly damaging Het
Dab2 T A 15: 6,422,343 F147I probably damaging Het
Etv1 T C 12: 38,780,936 M1T probably null Het
F2r T A 13: 95,604,739 D96V possibly damaging Het
Fancm A G 12: 65,102,650 D730G probably benign Het
Fbf1 T C 11: 116,146,739 I892V probably benign Het
Gbp8 T C 5: 105,050,869 N60S probably benign Het
Gm12790 T C 4: 101,968,083 I45V probably benign Het
Herc1 G A 9: 66,470,316 V3455I probably damaging Het
Hic1 T C 11: 75,165,585 D826G possibly damaging Het
Hmcn2 A G 2: 31,344,473 Y300C possibly damaging Het
Ifit1 A G 19: 34,647,668 Q68R probably benign Het
Igdcc4 A G 9: 65,122,738 Y309C probably damaging Het
Itpr3 T C 17: 27,107,737 probably null Het
Kat7 T C 11: 95,277,589 K414E probably damaging Het
Lmnb2 A T 10: 80,905,148 L260Q probably damaging Het
Mapk1 T C 16: 17,026,066 I215T noncoding transcript Het
Ntrk3 C A 7: 78,250,770 C607F probably damaging Het
Olfr1116 A T 2: 87,269,201 H119L probably benign Het
Olfr1136 T A 2: 87,693,361 I174F probably damaging Het
Olfr684 A G 7: 105,157,424 I86T probably damaging Het
Pcdh15 T C 10: 74,355,875 V601A probably damaging Het
Plagl2 A G 2: 153,232,319 C221R probably damaging Het
Shf A G 2: 122,349,487 Y195H probably damaging Het
Tapbpl T A 6: 125,226,721 Y332F probably damaging Het
Tbx15 G T 3: 99,351,989 C392F probably damaging Het
Ubxn7 T C 16: 32,375,276 L222P probably benign Het
Vprbp G A 9: 106,858,715 G954D probably damaging Het
Vsig8 A T 1: 172,561,511 D222V probably damaging Het
Xirp2 A G 2: 67,515,665 E2750G probably damaging Het
Zfp870 A G 17: 32,883,689 V222A possibly damaging Het
Other mutations in Ntpcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Ntpcr APN 8 125747762 missense probably damaging 0.98
IGL01582:Ntpcr APN 8 125745242 missense probably benign 0.11
IGL01862:Ntpcr APN 8 125736098 missense probably benign 0.14
IGL02045:Ntpcr APN 8 125745452 splice site probably benign
IGL02077:Ntpcr APN 8 125737368 nonsense probably null
R0491:Ntpcr UTSW 8 125737354 nonsense probably null
R0988:Ntpcr UTSW 8 125737431 splice site probably benign
R1781:Ntpcr UTSW 8 125745402 missense probably damaging 1.00
R2412:Ntpcr UTSW 8 125745405 missense probably damaging 1.00
R3838:Ntpcr UTSW 8 125737372 missense probably damaging 1.00
R4453:Ntpcr UTSW 8 125736190 missense probably benign 0.14
R6126:Ntpcr UTSW 8 125735887 critical splice donor site probably null
R6440:Ntpcr UTSW 8 125745242 missense probably damaging 0.97
R6463:Ntpcr UTSW 8 125736104 missense probably benign 0.02
R7102:Ntpcr UTSW 8 125730055 missense unknown
R7910:Ntpcr UTSW 8 125747744 missense probably benign
X0024:Ntpcr UTSW 8 125745426 missense probably damaging 0.99
X0025:Ntpcr UTSW 8 125745315 missense probably damaging 1.00
Z1177:Ntpcr UTSW 8 125745284 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGAGTCCAACCTTGTACACTC -3'
(R):5'- CTCAGGGCAACAGTCAATTGG -3'

Sequencing Primer
(F):5'- GTACACTCTCTCCTTTTATATGGGG -3'
(R):5'- ATTGGACTGCCTATCCTTAGCAAGG -3'
Posted On2020-07-13