Incidental Mutation 'R8230:Ccdc15'
ID637104
Institutional Source Beutler Lab
Gene Symbol Ccdc15
Ensembl Gene ENSMUSG00000034303
Gene Namecoiled-coil domain containing 15
SynonymsA630039F14Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081429; MGI: 2444488

Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R8230 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37275835-37348432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37315259 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 473 (E473G)
Ref Sequence ENSEMBL: ENSMUSP00000036784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037275]
Predicted Effect probably benign
Transcript: ENSMUST00000037275
AA Change: E473G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036784
Gene: ENSMUSG00000034303
AA Change: E473G

DomainStartEndE-ValueType
low complexity region 80 92 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
coiled coil region 173 202 N/A INTRINSIC
coiled coil region 652 686 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A G 15: 102,338,469 Y485H probably benign Het
Actl7a T A 4: 56,743,768 H98Q probably damaging Het
Adam15 G A 3: 89,345,610 T267I probably benign Het
Ankrd17 T C 5: 90,243,976 H1945R possibly damaging Het
Baiap3 A G 17: 25,246,853 I585T probably benign Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Cbx3 T C 6: 51,475,301 V32A probably damaging Het
Ccdc127 T C 13: 74,360,632 F50S unknown Het
Clasp2 A G 9: 113,892,414 D763G possibly damaging Het
Dab2 T A 15: 6,422,343 F147I probably damaging Het
Etv1 T C 12: 38,780,936 M1T probably null Het
F2r T A 13: 95,604,739 D96V possibly damaging Het
Fancm A G 12: 65,102,650 D730G probably benign Het
Fbf1 T C 11: 116,146,739 I892V probably benign Het
Gbp8 T C 5: 105,050,869 N60S probably benign Het
Gm12790 T C 4: 101,968,083 I45V probably benign Het
Herc1 G A 9: 66,470,316 V3455I probably damaging Het
Hic1 T C 11: 75,165,585 D826G possibly damaging Het
Hmcn2 A G 2: 31,344,473 Y300C possibly damaging Het
Ifit1 A G 19: 34,647,668 Q68R probably benign Het
Igdcc4 A G 9: 65,122,738 Y309C probably damaging Het
Itpr3 T C 17: 27,107,737 probably null Het
Kat7 T C 11: 95,277,589 K414E probably damaging Het
Lmnb2 A T 10: 80,905,148 L260Q probably damaging Het
Mapk1 T C 16: 17,026,066 I215T noncoding transcript Het
Ntpcr G T 8: 125,737,420 probably null Het
Ntrk3 C A 7: 78,250,770 C607F probably damaging Het
Olfr1116 A T 2: 87,269,201 H119L probably benign Het
Olfr1136 T A 2: 87,693,361 I174F probably damaging Het
Olfr684 A G 7: 105,157,424 I86T probably damaging Het
Pcdh15 T C 10: 74,355,875 V601A probably damaging Het
Plagl2 A G 2: 153,232,319 C221R probably damaging Het
Shf A G 2: 122,349,487 Y195H probably damaging Het
Tapbpl T A 6: 125,226,721 Y332F probably damaging Het
Tbx15 G T 3: 99,351,989 C392F probably damaging Het
Ubxn7 T C 16: 32,375,276 L222P probably benign Het
Vprbp G A 9: 106,858,715 G954D probably damaging Het
Vsig8 A T 1: 172,561,511 D222V probably damaging Het
Xirp2 A G 2: 67,515,665 E2750G probably damaging Het
Zfp870 A G 17: 32,883,689 V222A possibly damaging Het
Other mutations in Ccdc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Ccdc15 APN 9 37320473 missense probably damaging 1.00
IGL00823:Ccdc15 APN 9 37320413 missense probably benign 0.01
IGL00979:Ccdc15 APN 9 37316490 missense probably benign 0.44
IGL01380:Ccdc15 APN 9 37276557 utr 3 prime probably benign
IGL01832:Ccdc15 APN 9 37311344 missense probably damaging 0.97
IGL01845:Ccdc15 APN 9 37315236 nonsense probably null
IGL02375:Ccdc15 APN 9 37304332 missense probably damaging 0.99
F6893:Ccdc15 UTSW 9 37315640 missense probably damaging 0.97
FR4304:Ccdc15 UTSW 9 37315157 frame shift probably null
FR4449:Ccdc15 UTSW 9 37315158 frame shift probably null
R1743:Ccdc15 UTSW 9 37277477 nonsense probably null
R1848:Ccdc15 UTSW 9 37342570 missense probably benign 0.00
R1968:Ccdc15 UTSW 9 37347795 missense probably benign 0.05
R2006:Ccdc15 UTSW 9 37315472 missense possibly damaging 0.91
R2372:Ccdc15 UTSW 9 37315505 missense possibly damaging 0.64
R2932:Ccdc15 UTSW 9 37315658 missense probably benign 0.00
R3962:Ccdc15 UTSW 9 37320486 missense probably damaging 1.00
R5585:Ccdc15 UTSW 9 37277403 missense probably benign 0.00
R5919:Ccdc15 UTSW 9 37320396 critical splice donor site probably null
R6000:Ccdc15 UTSW 9 37315764 missense probably benign 0.00
R6198:Ccdc15 UTSW 9 37314285 critical splice donor site probably null
R6476:Ccdc15 UTSW 9 37342419 missense probably benign 0.04
R7098:Ccdc15 UTSW 9 37343960 missense probably damaging 1.00
R7485:Ccdc15 UTSW 9 37315278 missense probably benign
R7548:Ccdc15 UTSW 9 37277427 missense probably benign 0.45
R7627:Ccdc15 UTSW 9 37342402 missense unknown
R7807:Ccdc15 UTSW 9 37315382 missense probably benign 0.07
R8157:Ccdc15 UTSW 9 37315457 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGCCATTTCCAGCTTGG -3'
(R):5'- CAAAGGTCACTGTGTTCTCCC -3'

Sequencing Primer
(F):5'- ATCTCCAAATCAGCTGTAGAGG -3'
(R):5'- GTGTTCTCCCTAATTACTGGAATG -3'
Posted On2020-07-13