Incidental Mutation 'R0718:Vac14'
ID 63711
Institutional Source Beutler Lab
Gene Symbol Vac14
Ensembl Gene ENSMUSG00000010936
Gene Name Vac14 homolog (S. cerevisiae)
Synonyms Tax1bp2, Trx, D8Wsu151e, ingls
MMRRC Submission 038900-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0718 (G1)
Quality Score 103
Status Validated
Chromosome 8
Chromosomal Location 111345217-111447030 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 111359109 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 95 (I95K)
Ref Sequence ENSEMBL: ENSMUSP00000148548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034190] [ENSMUST00000212829] [ENSMUST00000213003]
AlphaFold Q80WQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000034190
AA Change: I95K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034190
Gene: ENSMUSG00000010936
AA Change: I95K

DomainStartEndE-ValueType
Pfam:Vac14_Fab1_bd 67 163 5.3e-43 PFAM
Pfam:Vac14_Fig4_bd 542 720 6.6e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212766
Predicted Effect probably damaging
Transcript: ENSMUST00000212829
AA Change: I95K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213003
AA Change: I95K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The content of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) in endosomal membranes changes dynamically with fission and fusion events that generate or absorb intracellular transport vesicles. VAC14 is a component of a trimolecular complex that tightly regulates the level of PtdIns(3,5)P2. Other components of this complex are the PtdIns(3,5)P2-synthesizing enzyme PIKFYVE (MIM 609414) and the PtdIns(3,5)P2 phosphatase FIG4 (MIM 609390). VAC14 functions as an activator of PIKFYVE (Sbrissa et al., 2007 [PubMed 17556371]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display early postnatal lethality with lesions in multiple regions of the brain. Mice homozygous for a hypomorphic allele exhibit postnatal lethality, spongiform degeneration, enlarged brain ventricles and coat color dilution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,586,918 (GRCm39) Y811N possibly damaging Het
Adrm1 T C 2: 179,816,940 (GRCm39) probably benign Het
Alms1 T A 6: 85,598,803 (GRCm39) S1210T probably benign Het
Ampd3 C T 7: 110,377,015 (GRCm39) P11L probably damaging Het
Arhgap5 A G 12: 52,563,290 (GRCm39) E87G possibly damaging Het
Armc5 C T 7: 127,839,242 (GRCm39) probably benign Het
Asic2 C G 11: 80,862,282 (GRCm39) probably benign Het
Asph A G 4: 9,514,683 (GRCm39) probably benign Het
Bicd2 T A 13: 49,531,351 (GRCm39) probably null Het
Brip1 A G 11: 86,034,131 (GRCm39) L530P possibly damaging Het
Bsn G T 9: 107,988,559 (GRCm39) probably benign Het
Btnl4 T A 17: 34,688,608 (GRCm39) H390L probably benign Het
Ccdc70 A C 8: 22,463,324 (GRCm39) K38T probably damaging Het
Ccni G A 5: 93,350,175 (GRCm39) P35S probably benign Het
Cdh17 A G 4: 11,810,451 (GRCm39) D714G possibly damaging Het
Cenpf A G 1: 189,386,181 (GRCm39) L2033P probably damaging Het
Cfap69 A T 5: 5,671,924 (GRCm39) M328K probably damaging Het
Cmah T G 13: 24,601,193 (GRCm39) probably null Het
Cog6 T C 3: 52,918,050 (GRCm39) T163A probably benign Het
Cyp2j8 G A 4: 96,389,433 (GRCm39) S130F probably benign Het
Dgki A G 6: 36,989,831 (GRCm39) V636A probably damaging Het
Dmkn T A 7: 30,464,211 (GRCm39) probably benign Het
Dnah6 A G 6: 73,012,276 (GRCm39) I3679T possibly damaging Het
Dsp A T 13: 38,380,740 (GRCm39) Y2495F possibly damaging Het
Exosc4 C T 15: 76,213,689 (GRCm39) A171V probably benign Het
Fbxw24 A G 9: 109,452,577 (GRCm39) probably benign Het
Flvcr1 A T 1: 190,757,779 (GRCm39) L171Q probably damaging Het
Fsd1 G T 17: 56,303,445 (GRCm39) probably null Het
Gm7732 A G 17: 21,350,106 (GRCm39) noncoding transcript Het
H2-K2 A C 17: 34,194,597 (GRCm39) noncoding transcript Het
Hgf A G 5: 16,798,857 (GRCm39) N295S probably damaging Het
Ift88 T A 14: 57,754,870 (GRCm39) D811E probably benign Het
Igsf9b T A 9: 27,234,657 (GRCm39) probably null Het
Immt T A 6: 71,840,156 (GRCm39) V311E probably damaging Het
Ipo11 T A 13: 107,056,119 (GRCm39) N51I possibly damaging Het
Isy1 T C 6: 87,796,158 (GRCm39) K260E probably damaging Het
Jchain T G 5: 88,674,061 (GRCm39) I28L probably benign Het
Jmjd1c T A 10: 67,054,725 (GRCm39) probably null Het
Kif13b T C 14: 64,989,111 (GRCm39) probably benign Het
Klhdc7b T C 15: 89,272,372 (GRCm39) Y427H possibly damaging Het
Klhl8 T C 5: 104,024,159 (GRCm39) probably benign Het
Lrp2 C T 2: 69,341,292 (GRCm39) D963N probably damaging Het
Ltbp3 G T 19: 5,796,776 (GRCm39) probably benign Het
Ltf C A 9: 110,869,447 (GRCm39) Q41K probably benign Het
Med4 T A 14: 73,754,097 (GRCm39) I148N probably damaging Het
Mlh3 T G 12: 85,294,471 (GRCm39) S1242R possibly damaging Het
Mllt6 T C 11: 97,567,185 (GRCm39) probably benign Het
Mpdz A G 4: 81,210,710 (GRCm39) I1712T possibly damaging Het
Mrgprb4 T A 7: 47,848,301 (GRCm39) H209L probably benign Het
Nkapl A T 13: 21,652,610 (GRCm39) M1K probably null Het
Nmur2 T A 11: 55,920,324 (GRCm39) probably benign Het
Nsun2 T A 13: 69,691,816 (GRCm39) probably benign Het
Or10ag60 A G 2: 87,438,271 (GRCm39) I180V probably benign Het
Or8k35 G A 2: 86,424,425 (GRCm39) T249I probably benign Het
Ovgp1 T C 3: 105,882,146 (GRCm39) probably benign Het
Pcdh8 A G 14: 80,008,131 (GRCm39) V144A possibly damaging Het
Pcnx3 G A 19: 5,727,756 (GRCm39) probably benign Het
Pla2r1 C A 2: 60,309,874 (GRCm39) V570L possibly damaging Het
Plxnd1 C A 6: 115,943,599 (GRCm39) E1202D possibly damaging Het
Ppp1r37 T C 7: 19,266,179 (GRCm39) E529G probably benign Het
Prdm15 A G 16: 97,613,833 (GRCm39) F496L possibly damaging Het
Prlhr G T 19: 60,456,497 (GRCm39) S23* probably null Het
Prlhr A T 19: 60,456,443 (GRCm39) V41D probably benign Het
Prpf4 C T 4: 62,332,777 (GRCm39) probably benign Het
Psg26 C T 7: 18,209,160 (GRCm39) R416H probably benign Het
Psg26 T C 7: 18,212,212 (GRCm39) H381R probably benign Het
Ralgds T G 2: 28,439,128 (GRCm39) M717R probably benign Het
Rbms1 T C 2: 60,672,756 (GRCm39) N44D probably damaging Het
Rpa1 T C 11: 75,209,227 (GRCm39) probably benign Het
Rprd2 T C 3: 95,673,699 (GRCm39) N568S probably benign Het
Rptor A G 11: 119,763,202 (GRCm39) M929V probably benign Het
Rspo1 T A 4: 124,900,942 (GRCm39) C97S possibly damaging Het
Scin C T 12: 40,129,606 (GRCm39) G396S probably damaging Het
Scn9a T C 2: 66,377,456 (GRCm39) N409D probably damaging Het
Sf3b1 A G 1: 55,058,544 (GRCm39) I15T probably damaging Het
Sh3bp2 T C 5: 34,712,839 (GRCm39) V149A probably damaging Het
Slc39a12 T A 2: 14,412,237 (GRCm39) probably benign Het
Sp9 G T 2: 73,104,171 (GRCm39) A242S possibly damaging Het
Srr A G 11: 74,801,891 (GRCm39) V126A possibly damaging Het
Tatdn3 G T 1: 190,785,046 (GRCm39) probably benign Het
Tex14 G A 11: 87,390,439 (GRCm39) V379I probably benign Het
Tmed6 T C 8: 107,788,356 (GRCm39) N197S probably damaging Het
Ttbk2 A T 2: 120,575,641 (GRCm39) I1043N probably benign Het
Ttbk2 G A 2: 120,579,056 (GRCm39) L689F probably benign Het
Ttn A G 2: 76,641,040 (GRCm39) S5283P probably damaging Het
Ube3b C A 5: 114,540,616 (GRCm39) S441* probably null Het
Ush2a G A 1: 188,530,027 (GRCm39) C3272Y probably damaging Het
Vangl2 G A 1: 171,833,784 (GRCm39) A433V probably damaging Het
Vwa5b1 A T 4: 138,336,135 (GRCm39) V153D probably damaging Het
Zfhx3 T A 8: 109,682,282 (GRCm39) D3240E unknown Het
Zfp945 A G 17: 23,070,004 (GRCm39) C632R probably damaging Het
Zfyve26 G A 12: 79,312,576 (GRCm39) probably benign Het
Zyg11b A T 4: 108,099,273 (GRCm39) I606N possibly damaging Het
Other mutations in Vac14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Vac14 APN 8 111,380,239 (GRCm39) splice site probably benign
IGL01511:Vac14 APN 8 111,439,430 (GRCm39) missense possibly damaging 0.93
IGL01724:Vac14 APN 8 111,345,523 (GRCm39) start codon destroyed probably null 1.00
IGL01784:Vac14 APN 8 111,397,800 (GRCm39) missense probably benign 0.00
IGL02086:Vac14 APN 8 111,379,950 (GRCm39) missense possibly damaging 0.74
IGL02447:Vac14 APN 8 111,380,260 (GRCm39) missense probably benign 0.39
IGL02614:Vac14 APN 8 111,361,750 (GRCm39) missense probably damaging 1.00
IGL03059:Vac14 APN 8 111,437,084 (GRCm39) missense probably damaging 1.00
IGL03155:Vac14 APN 8 111,362,975 (GRCm39) missense possibly damaging 0.90
Bathwater UTSW 8 111,438,252 (GRCm39) missense probably damaging 1.00
ducky UTSW 8 111,363,104 (GRCm39) splice site probably null
Rubber UTSW 8 111,397,674 (GRCm39) missense probably damaging 1.00
R0045:Vac14 UTSW 8 111,363,584 (GRCm39) missense probably benign 0.00
R0045:Vac14 UTSW 8 111,363,584 (GRCm39) missense probably benign 0.00
R0239:Vac14 UTSW 8 111,362,007 (GRCm39) critical splice acceptor site probably null
R0239:Vac14 UTSW 8 111,362,007 (GRCm39) critical splice acceptor site probably null
R1696:Vac14 UTSW 8 111,359,079 (GRCm39) critical splice acceptor site probably null
R1883:Vac14 UTSW 8 111,438,319 (GRCm39) missense probably damaging 1.00
R1884:Vac14 UTSW 8 111,438,319 (GRCm39) missense probably damaging 1.00
R1903:Vac14 UTSW 8 111,409,166 (GRCm39) missense probably benign 0.04
R2764:Vac14 UTSW 8 111,437,087 (GRCm39) missense probably damaging 1.00
R3000:Vac14 UTSW 8 111,360,949 (GRCm39) missense probably damaging 1.00
R3498:Vac14 UTSW 8 111,397,722 (GRCm39) missense probably benign
R4898:Vac14 UTSW 8 111,372,440 (GRCm39) missense probably benign
R5030:Vac14 UTSW 8 111,437,018 (GRCm39) missense possibly damaging 0.66
R5255:Vac14 UTSW 8 111,360,961 (GRCm39) missense probably damaging 0.99
R5918:Vac14 UTSW 8 111,363,104 (GRCm39) splice site probably null
R5930:Vac14 UTSW 8 111,436,981 (GRCm39) missense probably damaging 1.00
R7003:Vac14 UTSW 8 111,439,430 (GRCm39) missense probably damaging 0.99
R7092:Vac14 UTSW 8 111,442,128 (GRCm39) missense probably damaging 1.00
R7214:Vac14 UTSW 8 111,397,674 (GRCm39) missense probably damaging 1.00
R7327:Vac14 UTSW 8 111,438,252 (GRCm39) missense probably damaging 1.00
R7474:Vac14 UTSW 8 111,363,066 (GRCm39) missense probably damaging 1.00
R7741:Vac14 UTSW 8 111,361,020 (GRCm39) missense probably damaging 1.00
R8087:Vac14 UTSW 8 111,446,532 (GRCm39) missense probably benign
R8798:Vac14 UTSW 8 111,446,519 (GRCm39) missense probably benign 0.18
R8981:Vac14 UTSW 8 111,438,226 (GRCm39) missense probably damaging 0.99
R9051:Vac14 UTSW 8 111,379,869 (GRCm39) missense probably benign
R9319:Vac14 UTSW 8 111,361,018 (GRCm39) missense probably damaging 1.00
R9358:Vac14 UTSW 8 111,439,379 (GRCm39) critical splice acceptor site probably null
R9468:Vac14 UTSW 8 111,397,738 (GRCm39) missense probably benign 0.00
R9518:Vac14 UTSW 8 111,442,070 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGCCTCAGCAGGACCATTACAG -3'
(R):5'- GGGTGAACGGGACTTAACGATACAC -3'

Sequencing Primer
(F):5'- GACTTCTGCATTTAGGACTACTAGC -3'
(R):5'- TCAGACCTGGGCATTAAGTG -3'
Posted On 2013-07-30