Incidental Mutation 'R8230:Lmnb2'
ID 637110
Institutional Source Beutler Lab
Gene Symbol Lmnb2
Ensembl Gene ENSMUSG00000062075
Gene Name lamin B2
Synonyms lamin B3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8230 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 80901203-80918245 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80905148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 260 (L260Q)
Ref Sequence ENSEMBL: ENSMUSP00000057291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020440] [ENSMUST00000057623] [ENSMUST00000105332] [ENSMUST00000179022]
AlphaFold P21619
Predicted Effect probably benign
Transcript: ENSMUST00000020440
SMART Domains Protein: ENSMUSP00000020440
Gene: ENSMUSG00000020219

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:zf-Tim10_DDP 23 87 4.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000057623
AA Change: L260Q

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000057291
Gene: ENSMUSG00000062075
AA Change: L260Q

DomainStartEndE-ValueType
Filament 42 398 1.97e-47 SMART
low complexity region 402 422 N/A INTRINSIC
internal_repeat_1 427 442 1.72e-5 PROSPERO
low complexity region 444 458 N/A INTRINSIC
Pfam:LTD 462 575 9.3e-16 PFAM
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105332
AA Change: L119Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100969
Gene: ENSMUSG00000062075
AA Change: L119Q

DomainStartEndE-ValueType
Pfam:Filament 77 257 1.2e-49 PFAM
low complexity region 261 281 N/A INTRINSIC
Pfam:LTD 317 435 6.7e-23 PFAM
low complexity region 438 455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179022
AA Change: L241Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136524
Gene: ENSMUSG00000062075
AA Change: L241Q

DomainStartEndE-ValueType
Pfam:Filament 23 379 8.9e-96 PFAM
low complexity region 383 403 N/A INTRINSIC
internal_repeat_1 408 423 1.1e-5 PROSPERO
Pfam:LTD 439 557 1.3e-23 PFAM
low complexity region 560 577 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B type nuclear lamin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Mutations in this gene are associated with acquired partial lipodystrophy. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal death with abnormal brain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A G 15: 102,338,469 Y485H probably benign Het
Actl7a T A 4: 56,743,768 H98Q probably damaging Het
Adam15 G A 3: 89,345,610 T267I probably benign Het
Ankrd17 T C 5: 90,243,976 H1945R possibly damaging Het
Baiap3 A G 17: 25,246,853 I585T probably benign Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Cbx3 T C 6: 51,475,301 V32A probably damaging Het
Ccdc127 T C 13: 74,360,632 F50S unknown Het
Ccdc15 T C 9: 37,315,259 E473G probably benign Het
Clasp2 A G 9: 113,892,414 D763G possibly damaging Het
Dab2 T A 15: 6,422,343 F147I probably damaging Het
Etv1 T C 12: 38,780,936 M1T probably null Het
F2r T A 13: 95,604,739 D96V possibly damaging Het
Fancm A G 12: 65,102,650 D730G probably benign Het
Fbf1 T C 11: 116,146,739 I892V probably benign Het
Gbp8 T C 5: 105,050,869 N60S probably benign Het
Gm12790 T C 4: 101,968,083 I45V probably benign Het
Herc1 G A 9: 66,470,316 V3455I probably damaging Het
Hic1 T C 11: 75,165,585 D826G possibly damaging Het
Hmcn2 A G 2: 31,344,473 Y300C possibly damaging Het
Ifit1 A G 19: 34,647,668 Q68R probably benign Het
Igdcc4 A G 9: 65,122,738 Y309C probably damaging Het
Itpr3 T C 17: 27,107,737 probably null Het
Kat7 T C 11: 95,277,589 K414E probably damaging Het
Mapk1 T C 16: 17,026,066 I215T noncoding transcript Het
Ntpcr G T 8: 125,737,420 probably null Het
Ntrk3 C A 7: 78,250,770 C607F probably damaging Het
Olfr1116 A T 2: 87,269,201 H119L probably benign Het
Olfr1136 T A 2: 87,693,361 I174F probably damaging Het
Olfr684 A G 7: 105,157,424 I86T probably damaging Het
Pcdh15 T C 10: 74,355,875 V601A probably damaging Het
Plagl2 A G 2: 153,232,319 C221R probably damaging Het
Shf A G 2: 122,349,487 Y195H probably damaging Het
Tapbpl T A 6: 125,226,721 Y332F probably damaging Het
Tbx15 G T 3: 99,351,989 C392F probably damaging Het
Ubxn7 T C 16: 32,375,276 L222P probably benign Het
Vprbp G A 9: 106,858,715 G954D probably damaging Het
Vsig8 A T 1: 172,561,511 D222V probably damaging Het
Xirp2 A G 2: 67,515,665 E2750G probably damaging Het
Zfp870 A G 17: 32,883,689 V222A possibly damaging Het
Other mutations in Lmnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Lmnb2 APN 10 80904037 missense possibly damaging 0.92
IGL00908:Lmnb2 APN 10 80909987 missense probably damaging 0.99
IGL01365:Lmnb2 APN 10 80904984 missense probably benign 0.07
IGL01598:Lmnb2 APN 10 80907165 missense probably benign 0.00
R0761:Lmnb2 UTSW 10 80906254 start codon destroyed probably null 0.03
R1143:Lmnb2 UTSW 10 80904315 unclassified probably benign
R1324:Lmnb2 UTSW 10 80904171 missense possibly damaging 0.60
R1763:Lmnb2 UTSW 10 80907191 missense probably damaging 1.00
R2229:Lmnb2 UTSW 10 80904392 unclassified probably benign
R5001:Lmnb2 UTSW 10 80918112 missense probably damaging 0.98
R5053:Lmnb2 UTSW 10 80904655 missense probably damaging 1.00
R5334:Lmnb2 UTSW 10 80903957 missense probably benign 0.08
R5713:Lmnb2 UTSW 10 80906087 missense probably damaging 0.97
R5975:Lmnb2 UTSW 10 80905128 nonsense probably null
R6314:Lmnb2 UTSW 10 80909970 missense probably damaging 1.00
R6835:Lmnb2 UTSW 10 80909960 missense probably damaging 1.00
R7663:Lmnb2 UTSW 10 80904739 missense probably damaging 1.00
R7776:Lmnb2 UTSW 10 80918157 missense possibly damaging 0.52
R8728:Lmnb2 UTSW 10 80905079 critical splice donor site probably null
R9032:Lmnb2 UTSW 10 80904257 missense probably benign 0.03
R9063:Lmnb2 UTSW 10 80906171 missense probably benign 0.00
R9085:Lmnb2 UTSW 10 80904257 missense probably benign 0.03
Z1176:Lmnb2 UTSW 10 80903238 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTTGGAGGCCTAAAAGCTG -3'
(R):5'- ACATGACCAGGCACCTAGAG -3'

Sequencing Primer
(F):5'- TTGGAGGCCTAAAAGCTGGTAGC -3'
(R):5'- GGCACCTAGAGATAAAACCTGGC -3'
Posted On 2020-07-13