Incidental Mutation 'R8230:Aaas'
ID 637119
Institutional Source Beutler Lab
Gene Symbol Aaas
Ensembl Gene ENSMUSG00000036678
Gene Name achalasia, adrenocortical insufficiency, alacrimia
Synonyms GL003, D030041N15Rik, Aladin
MMRRC Submission 067662-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.501) question?
Stock # R8230 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 102246682-102259194 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102246904 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 485 (Y485H)
Ref Sequence ENSEMBL: ENSMUSP00000044604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001331] [ENSMUST00000041208] [ENSMUST00000113682]
AlphaFold P58742
Predicted Effect probably benign
Transcript: ENSMUST00000001331
SMART Domains Protein: ENSMUSP00000001331
Gene: ENSMUSG00000001285

DomainStartEndE-ValueType
Pfam:UPF0160 41 161 4.8e-54 PFAM
Pfam:UPF0160 158 312 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041208
AA Change: Y485H

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000044604
Gene: ENSMUSG00000036678
AA Change: Y485H

DomainStartEndE-ValueType
WD40 136 179 3.7e0 SMART
WD40 181 221 4.75e1 SMART
WD40 232 273 1.17e-5 SMART
WD40 278 315 2.66e0 SMART
Blast:WD40 319 357 2e-15 BLAST
low complexity region 534 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113682
SMART Domains Protein: ENSMUSP00000109312
Gene: ENSMUSG00000001285

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UPF0160 45 365 1.5e-143 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171244
SMART Domains Protein: ENSMUSP00000129494
Gene: ENSMUSG00000001285

DomainStartEndE-ValueType
Pfam:UPF0160 41 209 1.7e-76 PFAM
Pfam:UPF0160 204 306 3.3e-43 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be involved in normal development of the peripheral and central nervous system. The encoded protein is part of the nuclear pore complex and is anchored there by NDC1. Defects in this gene are a cause of achalasia-addisonianism-alacrima syndrome (AAAS), also called triple-A syndrome or Allgrove syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice display female infertility, mildly decreased exploratory behavior, and decreased body weight, but have normal adrenocortical function and do not develop severe neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a T A 4: 56,743,768 (GRCm39) H98Q probably damaging Het
Adam15 G A 3: 89,252,917 (GRCm39) T267I probably benign Het
Ankrd17 T C 5: 90,391,835 (GRCm39) H1945R possibly damaging Het
Baiap3 A G 17: 25,465,827 (GRCm39) I585T probably benign Het
Bcl6 T C 16: 23,791,652 (GRCm39) D234G probably damaging Het
Cbx3 T C 6: 51,452,281 (GRCm39) V32A probably damaging Het
Ccdc127 T C 13: 74,508,751 (GRCm39) F50S unknown Het
Ccdc15 T C 9: 37,226,555 (GRCm39) E473G probably benign Het
Clasp2 A G 9: 113,721,482 (GRCm39) D763G possibly damaging Het
Dab2 T A 15: 6,451,824 (GRCm39) F147I probably damaging Het
Dcaf1 G A 9: 106,735,914 (GRCm39) G954D probably damaging Het
Etv1 T C 12: 38,830,935 (GRCm39) M1T probably null Het
F2r T A 13: 95,741,247 (GRCm39) D96V possibly damaging Het
Fancm A G 12: 65,149,424 (GRCm39) D730G probably benign Het
Fbf1 T C 11: 116,037,565 (GRCm39) I892V probably benign Het
Gbp8 T C 5: 105,198,735 (GRCm39) N60S probably benign Het
Gm12790 T C 4: 101,825,280 (GRCm39) I45V probably benign Het
Herc1 G A 9: 66,377,598 (GRCm39) V3455I probably damaging Het
Hic1 T C 11: 75,056,411 (GRCm39) D826G possibly damaging Het
Hmcn2 A G 2: 31,234,485 (GRCm39) Y300C possibly damaging Het
Ifit1 A G 19: 34,625,068 (GRCm39) Q68R probably benign Het
Igdcc4 A G 9: 65,030,020 (GRCm39) Y309C probably damaging Het
Itpr3 T C 17: 27,326,711 (GRCm39) probably null Het
Kat7 T C 11: 95,168,415 (GRCm39) K414E probably damaging Het
Lmnb2 A T 10: 80,740,982 (GRCm39) L260Q probably damaging Het
Mapk1 T C 16: 16,843,930 (GRCm39) I215T noncoding transcript Het
Ntpcr G T 8: 126,464,159 (GRCm39) probably null Het
Ntrk3 C A 7: 77,900,518 (GRCm39) C607F probably damaging Het
Or10ag54 A T 2: 87,099,545 (GRCm39) H119L probably benign Het
Or56a4 A G 7: 104,806,631 (GRCm39) I86T probably damaging Het
Or5w13 T A 2: 87,523,705 (GRCm39) I174F probably damaging Het
Pcdh15 T C 10: 74,191,707 (GRCm39) V601A probably damaging Het
Plagl2 A G 2: 153,074,239 (GRCm39) C221R probably damaging Het
Shf A G 2: 122,179,968 (GRCm39) Y195H probably damaging Het
Tapbpl T A 6: 125,203,684 (GRCm39) Y332F probably damaging Het
Tbx15 G T 3: 99,259,305 (GRCm39) C392F probably damaging Het
Ubxn7 T C 16: 32,194,094 (GRCm39) L222P probably benign Het
Vsig8 A T 1: 172,389,078 (GRCm39) D222V probably damaging Het
Xirp2 A G 2: 67,346,009 (GRCm39) E2750G probably damaging Het
Zfp870 A G 17: 33,102,663 (GRCm39) V222A possibly damaging Het
Other mutations in Aaas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Aaas APN 15 102,247,809 (GRCm39) missense possibly damaging 0.77
IGL01620:Aaas APN 15 102,248,385 (GRCm39) missense probably damaging 1.00
IGL02337:Aaas APN 15 102,247,662 (GRCm39) missense probably benign 0.01
IGL02608:Aaas APN 15 102,247,627 (GRCm39) missense probably benign 0.00
IGL03024:Aaas APN 15 102,258,926 (GRCm39) splice site probably benign
IGL03217:Aaas APN 15 102,258,430 (GRCm39) missense probably damaging 1.00
IGL03273:Aaas APN 15 102,258,430 (GRCm39) missense probably damaging 1.00
Shrinker UTSW 15 102,255,111 (GRCm39) critical splice donor site probably null
R1545:Aaas UTSW 15 102,247,641 (GRCm39) missense probably damaging 1.00
R1546:Aaas UTSW 15 102,255,153 (GRCm39) missense probably benign 0.00
R1957:Aaas UTSW 15 102,247,068 (GRCm39) unclassified probably benign
R1996:Aaas UTSW 15 102,248,494 (GRCm39) missense probably benign 0.10
R1997:Aaas UTSW 15 102,248,494 (GRCm39) missense probably benign 0.10
R3079:Aaas UTSW 15 102,248,879 (GRCm39) missense probably damaging 0.99
R3715:Aaas UTSW 15 102,248,771 (GRCm39) missense probably benign 0.01
R5427:Aaas UTSW 15 102,248,385 (GRCm39) missense possibly damaging 0.94
R5586:Aaas UTSW 15 102,255,111 (GRCm39) critical splice donor site probably null
R5620:Aaas UTSW 15 102,246,826 (GRCm39) missense probably benign 0.00
R5969:Aaas UTSW 15 102,258,999 (GRCm39) missense probably damaging 1.00
R6763:Aaas UTSW 15 102,248,457 (GRCm39) missense probably null
R8698:Aaas UTSW 15 102,247,250 (GRCm39) critical splice donor site probably benign
R8755:Aaas UTSW 15 102,255,520 (GRCm39) missense probably benign 0.00
R9081:Aaas UTSW 15 102,248,502 (GRCm39) missense probably damaging 1.00
R9283:Aaas UTSW 15 102,258,499 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTCGGAGTTACATCCTGG -3'
(R):5'- CAAAGGGGCCTTGCTTAGTG -3'

Sequencing Primer
(F):5'- CTCGGAGTTACATCCTGGTAAATGAG -3'
(R):5'- CCTTGCTTAGTGTGGTGAGTC -3'
Posted On 2020-07-13