Incidental Mutation 'R8230:Baiap3'
ID637123
Institutional Source Beutler Lab
Gene Symbol Baiap3
Ensembl Gene ENSMUSG00000047507
Gene NameBAI1-associated protein 3
SynonymsLOC381076
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8230 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25242659-25256364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25246853 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 585 (I585T)
Ref Sequence ENSEMBL: ENSMUSP00000138188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063574] [ENSMUST00000169109] [ENSMUST00000182056] [ENSMUST00000182435] [ENSMUST00000182825]
Predicted Effect probably benign
Transcript: ENSMUST00000063574
SMART Domains Protein: ENSMUSP00000068511
Gene: ENSMUSG00000015126

DomainStartEndE-ValueType
Pfam:RLI 58 92 8.2e-17 PFAM
Pfam:DUF367 96 222 1.3e-56 PFAM
low complexity region 261 282 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000129854
Gene: ENSMUSG00000047507
AA Change: I562T

DomainStartEndE-ValueType
C2 159 328 4.73e-17 SMART
low complexity region 361 379 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 497 509 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 857 868 N/A INTRINSIC
Pfam:Membr_traf_MHD 896 958 8e-10 PFAM
C2 989 1097 7.06e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182056
AA Change: I585T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138188
Gene: ENSMUSG00000047507
AA Change: I585T

DomainStartEndE-ValueType
C2 159 328 4.73e-17 SMART
low complexity region 361 379 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 497 509 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
Pfam:Membr_traf_MHD 851 959 3.3e-30 PFAM
C2 989 1097 7.06e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182435
AA Change: I557T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138796
Gene: ENSMUSG00000047507
AA Change: I557T

DomainStartEndE-ValueType
C2 131 300 4.73e-17 SMART
low complexity region 333 351 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Membr_traf_MHD 823 931 3.2e-30 PFAM
C2 961 1069 7.06e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182696
Predicted Effect probably benign
Transcript: ENSMUST00000182825
AA Change: I549T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138254
Gene: ENSMUSG00000047507
AA Change: I549T

DomainStartEndE-ValueType
C2 159 284 4.05e-16 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 461 473 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
Pfam:Membr_traf_MHD 815 923 3.2e-30 PFAM
C2 953 1061 7.06e-16 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor. The protein is a seven-span transmembrane protein and a member of the secretin receptor family. It interacts with the cytoplasmic region of brain-specific angiogenesis inhibitor 1. This protein also contains two C2 domains, which are often found in proteins involved in signal transduction or membrane trafficking. Its expression pattern and similarity to other proteins suggest that it may be involved in synaptic functions. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile but exhibit increased PTZ-induced seizure propensity, as well as increased novelty-induced anxiety in both genders, with a more pronounced effect in females, and a faster developmentof tolerance to benzodiazepines in male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A G 15: 102,338,469 Y485H probably benign Het
Actl7a T A 4: 56,743,768 H98Q probably damaging Het
Adam15 G A 3: 89,345,610 T267I probably benign Het
Ankrd17 T C 5: 90,243,976 H1945R possibly damaging Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Cbx3 T C 6: 51,475,301 V32A probably damaging Het
Ccdc127 T C 13: 74,360,632 F50S unknown Het
Ccdc15 T C 9: 37,315,259 E473G probably benign Het
Clasp2 A G 9: 113,892,414 D763G possibly damaging Het
Dab2 T A 15: 6,422,343 F147I probably damaging Het
Etv1 T C 12: 38,780,936 M1T probably null Het
F2r T A 13: 95,604,739 D96V possibly damaging Het
Fancm A G 12: 65,102,650 D730G probably benign Het
Fbf1 T C 11: 116,146,739 I892V probably benign Het
Gbp8 T C 5: 105,050,869 N60S probably benign Het
Gm12790 T C 4: 101,968,083 I45V probably benign Het
Herc1 G A 9: 66,470,316 V3455I probably damaging Het
Hic1 T C 11: 75,165,585 D826G possibly damaging Het
Hmcn2 A G 2: 31,344,473 Y300C possibly damaging Het
Ifit1 A G 19: 34,647,668 Q68R probably benign Het
Igdcc4 A G 9: 65,122,738 Y309C probably damaging Het
Itpr3 T C 17: 27,107,737 probably null Het
Kat7 T C 11: 95,277,589 K414E probably damaging Het
Lmnb2 A T 10: 80,905,148 L260Q probably damaging Het
Mapk1 T C 16: 17,026,066 I215T noncoding transcript Het
Ntpcr G T 8: 125,737,420 probably null Het
Ntrk3 C A 7: 78,250,770 C607F probably damaging Het
Olfr1116 A T 2: 87,269,201 H119L probably benign Het
Olfr1136 T A 2: 87,693,361 I174F probably damaging Het
Olfr684 A G 7: 105,157,424 I86T probably damaging Het
Pcdh15 T C 10: 74,355,875 V601A probably damaging Het
Plagl2 A G 2: 153,232,319 C221R probably damaging Het
Shf A G 2: 122,349,487 Y195H probably damaging Het
Tapbpl T A 6: 125,226,721 Y332F probably damaging Het
Tbx15 G T 3: 99,351,989 C392F probably damaging Het
Ubxn7 T C 16: 32,375,276 L222P probably benign Het
Vprbp G A 9: 106,858,715 G954D probably damaging Het
Vsig8 A T 1: 172,561,511 D222V probably damaging Het
Xirp2 A G 2: 67,515,665 E2750G probably damaging Het
Zfp870 A G 17: 32,883,689 V222A possibly damaging Het
Other mutations in Baiap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Baiap3 APN 17 25244328 missense probably damaging 1.00
IGL00486:Baiap3 APN 17 25248377 splice site probably benign
IGL00820:Baiap3 APN 17 25248690 missense probably benign 0.20
IGL01443:Baiap3 APN 17 25245147 missense possibly damaging 0.92
IGL02282:Baiap3 APN 17 25249377 missense probably benign 0.11
IGL02341:Baiap3 APN 17 25248316 missense possibly damaging 0.52
IGL02669:Baiap3 APN 17 25244348 missense probably damaging 1.00
IGL02863:Baiap3 APN 17 25244502 splice site probably benign
IGL02993:Baiap3 APN 17 25250082 critical splice donor site probably null
R0021:Baiap3 UTSW 17 25243669 missense probably damaging 1.00
R0090:Baiap3 UTSW 17 25250070 splice site probably benign
R0276:Baiap3 UTSW 17 25243687 missense probably damaging 1.00
R0488:Baiap3 UTSW 17 25248470 critical splice donor site probably null
R0826:Baiap3 UTSW 17 25245229 missense possibly damaging 0.89
R0883:Baiap3 UTSW 17 25249101 missense probably damaging 1.00
R1700:Baiap3 UTSW 17 25249328 missense probably damaging 1.00
R1702:Baiap3 UTSW 17 25244805 missense probably damaging 1.00
R2336:Baiap3 UTSW 17 25250404 missense probably damaging 1.00
R2762:Baiap3 UTSW 17 25244575 missense probably damaging 1.00
R4454:Baiap3 UTSW 17 25249536 missense probably damaging 1.00
R4540:Baiap3 UTSW 17 25246670 missense probably damaging 1.00
R4609:Baiap3 UTSW 17 25250261 missense probably damaging 1.00
R4816:Baiap3 UTSW 17 25247295 splice site probably benign
R4979:Baiap3 UTSW 17 25246362 missense possibly damaging 0.57
R5069:Baiap3 UTSW 17 25249108 missense probably damaging 0.99
R5070:Baiap3 UTSW 17 25249108 missense probably damaging 0.99
R5093:Baiap3 UTSW 17 25250269 missense probably damaging 1.00
R5130:Baiap3 UTSW 17 25245342 missense probably benign 0.01
R5566:Baiap3 UTSW 17 25251733 missense probably damaging 1.00
R5572:Baiap3 UTSW 17 25251475 missense possibly damaging 0.86
R5681:Baiap3 UTSW 17 25249373 missense probably damaging 1.00
R5730:Baiap3 UTSW 17 25247524 missense probably benign 0.01
R5743:Baiap3 UTSW 17 25244785 missense probably benign 0.02
R5805:Baiap3 UTSW 17 25247515 missense probably benign 0.12
R6038:Baiap3 UTSW 17 25246334 missense probably damaging 1.00
R6038:Baiap3 UTSW 17 25246334 missense probably damaging 1.00
R6052:Baiap3 UTSW 17 25248470 critical splice donor site probably benign
R6238:Baiap3 UTSW 17 25245758 missense probably benign 0.00
R6700:Baiap3 UTSW 17 25244026 missense probably damaging 1.00
R7037:Baiap3 UTSW 17 25243840 missense probably benign
R7038:Baiap3 UTSW 17 25243840 missense probably benign
R7039:Baiap3 UTSW 17 25243840 missense probably benign
R7126:Baiap3 UTSW 17 25245145 missense possibly damaging 0.64
R7198:Baiap3 UTSW 17 25243840 missense probably benign
R7223:Baiap3 UTSW 17 25243840 missense probably benign
R7291:Baiap3 UTSW 17 25244317 missense probably damaging 1.00
R7438:Baiap3 UTSW 17 25249108 missense possibly damaging 0.91
R7687:Baiap3 UTSW 17 25249337 missense possibly damaging 0.88
R7877:Baiap3 UTSW 17 25251138 missense probably damaging 0.99
R8172:Baiap3 UTSW 17 25244122 missense probably damaging 1.00
R8184:Baiap3 UTSW 17 25248525 missense probably benign 0.00
R8240:Baiap3 UTSW 17 25245314 critical splice donor site probably null
R8394:Baiap3 UTSW 17 25250122 missense probably benign
X0017:Baiap3 UTSW 17 25248350 missense possibly damaging 0.92
Z1176:Baiap3 UTSW 17 25244768 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CCACCTCTAAGTTCATCTTGGGG -3'
(R):5'- TTGAGCTTGCAGACATCATCTATG -3'

Sequencing Primer
(F):5'- CTAAGTTCATCTTGGGGCTCAGC -3'
(R):5'- GCTTGCAGACATCATCTATGAGGAC -3'
Posted On2020-07-13