Incidental Mutation 'R8231:Dbh'
ID637129
Institutional Source Beutler Lab
Gene Symbol Dbh
Ensembl Gene ENSMUSG00000000889
Gene Namedopamine beta hydroxylase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location27165233-27183200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27170543 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 244 (R244C)
Ref Sequence ENSEMBL: ENSMUSP00000000910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000910]
Predicted Effect probably benign
Transcript: ENSMUST00000000910
AA Change: R244C

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000000910
Gene: ENSMUSG00000000889
AA Change: R244C

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
DoH 88 177 6.62e-8 SMART
Pfam:Cu2_monooxygen 217 345 4.9e-47 PFAM
Pfam:Cu2_monoox_C 364 520 3.6e-67 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an oxidoreductase belonging to the copper type II, ascorbate-dependent monooxygenase family. It is present in the synaptic vesicles of postganglionic sympathetic neurons and converts dopamine to norepinephrine. It exists in both soluble and membrane-bound forms, depending on the absence or presence, respectively, of a signal peptide. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are embryonic lethal probably due to cardiovascular failure, but survive if treated to replace their dopamine deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in Dbh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Dbh APN 2 27165544 missense probably benign 0.00
IGL02169:Dbh APN 2 27174898 missense probably damaging 1.00
IGL02297:Dbh APN 2 27177736 missense probably benign
IGL02940:Dbh APN 2 27168309 missense probably damaging 1.00
IGL03100:Dbh APN 2 27165522 missense probably benign 0.08
IGL03290:Dbh APN 2 27174932 missense probably damaging 1.00
R0020:Dbh UTSW 2 27170572 splice site probably benign
R1908:Dbh UTSW 2 27181494 missense possibly damaging 0.66
R1914:Dbh UTSW 2 27168222 missense probably damaging 1.00
R1915:Dbh UTSW 2 27168222 missense probably damaging 1.00
R2328:Dbh UTSW 2 27165730 missense probably benign
R3406:Dbh UTSW 2 27174965 missense possibly damaging 0.70
R4475:Dbh UTSW 2 27180972 splice site probably null
R4532:Dbh UTSW 2 27177331 missense possibly damaging 0.65
R4533:Dbh UTSW 2 27177331 missense possibly damaging 0.65
R4619:Dbh UTSW 2 27174824 missense probably damaging 1.00
R5920:Dbh UTSW 2 27177231 intron probably benign
R6936:Dbh UTSW 2 27172797 missense probably benign
R7047:Dbh UTSW 2 27165610 missense possibly damaging 0.87
R7121:Dbh UTSW 2 27168306 missense probably damaging 1.00
R7591:Dbh UTSW 2 27170510 missense probably damaging 1.00
R7753:Dbh UTSW 2 27171436 missense probably benign 0.00
R7814:Dbh UTSW 2 27174848 missense probably damaging 1.00
R8037:Dbh UTSW 2 27165688 missense probably damaging 1.00
R8398:Dbh UTSW 2 27174898 missense probably damaging 1.00
Z1176:Dbh UTSW 2 27177727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCATTTCAGTCGCTGG -3'
(R):5'- TCCAGGCAGGTAAGATAGGAAATATTC -3'

Sequencing Primer
(F):5'- ATTTCAGTCGCTGGAGGCCATC -3'
(R):5'- TAGGAAATATTCATCTCAGGGGCCC -3'
Posted On2020-07-13