Incidental Mutation 'R0718:Bsn'
ID63713
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
MMRRC Submission 038900-MU
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R0718 (G1)
Quality Score160
Status Validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 108111360 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: L2398M
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: L2398M

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Meta Mutation Damage Score 0.1498 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,679,608 Y811N possibly damaging Het
Adrm1 T C 2: 180,175,147 probably benign Het
Alms1 T A 6: 85,621,821 S1210T probably benign Het
Ampd3 C T 7: 110,777,808 P11L probably damaging Het
Arhgap5 A G 12: 52,516,507 E87G possibly damaging Het
Armc5 C T 7: 128,240,070 probably benign Het
Asic2 C G 11: 80,971,456 probably benign Het
Asph A G 4: 9,514,683 probably benign Het
Bicd2 T A 13: 49,377,875 probably null Het
Brip1 A G 11: 86,143,305 L530P possibly damaging Het
Btnl4 T A 17: 34,469,634 H390L probably benign Het
Ccdc70 A C 8: 21,973,308 K38T probably damaging Het
Ccni G A 5: 93,202,316 P35S probably benign Het
Cdh17 A G 4: 11,810,451 D714G possibly damaging Het
Cenpf A G 1: 189,653,984 L2033P probably damaging Het
Cfap69 A T 5: 5,621,924 M328K probably damaging Het
Cmah T G 13: 24,417,210 probably null Het
Cog6 T C 3: 53,010,629 T163A probably benign Het
Cyp2j8 G A 4: 96,501,196 S130F probably benign Het
Dgki A G 6: 37,012,896 V636A probably damaging Het
Dmkn T A 7: 30,764,786 probably benign Het
Dnah6 A G 6: 73,035,293 I3679T possibly damaging Het
Dsp A T 13: 38,196,764 Y2495F possibly damaging Het
Exosc4 C T 15: 76,329,489 A171V probably benign Het
Fbxw24 A G 9: 109,623,509 probably benign Het
Flvcr1 A T 1: 191,025,582 L171Q probably damaging Het
Fsd1 G T 17: 55,996,445 probably null Het
Gm7732 A G 17: 21,129,844 noncoding transcript Het
H2-K2 A C 17: 33,975,623 noncoding transcript Het
Hgf A G 5: 16,593,859 N295S probably damaging Het
Ift88 T A 14: 57,517,413 D811E probably benign Het
Igsf9b T A 9: 27,323,361 probably null Het
Immt T A 6: 71,863,172 V311E probably damaging Het
Ipo11 T A 13: 106,919,611 N51I possibly damaging Het
Isy1 T C 6: 87,819,176 K260E probably damaging Het
Jchain T G 5: 88,526,202 I28L probably benign Het
Jmjd1c T A 10: 67,218,946 probably null Het
Kif13b T C 14: 64,751,662 probably benign Het
Klhdc7b T C 15: 89,388,169 Y427H possibly damaging Het
Klhl8 T C 5: 103,876,293 probably benign Het
Lrp2 C T 2: 69,510,948 D963N probably damaging Het
Ltbp3 G T 19: 5,746,748 probably benign Het
Ltf C A 9: 111,040,379 Q41K probably benign Het
Med4 T A 14: 73,516,657 I148N probably damaging Het
Mlh3 T G 12: 85,247,697 S1242R possibly damaging Het
Mllt6 T C 11: 97,676,359 probably benign Het
Mpdz A G 4: 81,292,473 I1712T possibly damaging Het
Mrgprb4 T A 7: 48,198,553 H209L probably benign Het
Nkapl A T 13: 21,468,440 M1K probably null Het
Nmur2 T A 11: 56,029,498 probably benign Het
Nsun2 T A 13: 69,543,697 probably benign Het
Olfr1082 G A 2: 86,594,081 T249I probably benign Het
Olfr1130 A G 2: 87,607,927 I180V probably benign Het
Ovgp1 T C 3: 105,974,830 probably benign Het
Pcdh8 A G 14: 79,770,691 V144A possibly damaging Het
Pcnx3 G A 19: 5,677,728 probably benign Het
Pla2r1 C A 2: 60,479,530 V570L possibly damaging Het
Plxnd1 C A 6: 115,966,638 E1202D possibly damaging Het
Ppp1r37 T C 7: 19,532,254 E529G probably benign Het
Prdm15 A G 16: 97,812,633 F496L possibly damaging Het
Prlhr A T 19: 60,468,005 V41D probably benign Het
Prlhr G T 19: 60,468,059 S23* probably null Het
Prpf4 C T 4: 62,414,540 probably benign Het
Psg26 C T 7: 18,475,235 R416H probably benign Het
Psg26 T C 7: 18,478,287 H381R probably benign Het
Ralgds T G 2: 28,549,116 M717R probably benign Het
Rbms1 T C 2: 60,842,412 N44D probably damaging Het
Rpa1 T C 11: 75,318,401 probably benign Het
Rprd2 T C 3: 95,766,387 N568S probably benign Het
Rptor A G 11: 119,872,376 M929V probably benign Het
Rspo1 T A 4: 125,007,149 C97S possibly damaging Het
Scin C T 12: 40,079,607 G396S probably damaging Het
Scn9a T C 2: 66,547,112 N409D probably damaging Het
Sf3b1 A G 1: 55,019,385 I15T probably damaging Het
Sh3bp2 T C 5: 34,555,495 V149A probably damaging Het
Slc39a12 T A 2: 14,407,426 probably benign Het
Sp9 G T 2: 73,273,827 A242S possibly damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tatdn3 G T 1: 191,052,849 probably benign Het
Tex14 G A 11: 87,499,613 V379I probably benign Het
Tmed6 T C 8: 107,061,724 N197S probably damaging Het
Ttbk2 G A 2: 120,748,575 L689F probably benign Het
Ttbk2 A T 2: 120,745,160 I1043N probably benign Het
Ttn A G 2: 76,810,696 S5283P probably damaging Het
Ube3b C A 5: 114,402,555 S441* probably null Het
Ush2a G A 1: 188,797,830 C3272Y probably damaging Het
Vac14 T A 8: 110,632,477 I95K probably damaging Het
Vangl2 G A 1: 172,006,217 A433V probably damaging Het
Vwa5b1 A T 4: 138,608,824 V153D probably damaging Het
Zfhx3 T A 8: 108,955,650 D3240E unknown Het
Zfp945 A G 17: 22,851,030 C632R probably damaging Het
Zfyve26 G A 12: 79,265,802 probably benign Het
Zyg11b A T 4: 108,242,076 I606N possibly damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7951:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7980:Bsn UTSW 9 108111866 missense probably damaging 0.98
R8022:Bsn UTSW 9 108114404 missense probably benign 0.01
R8056:Bsn UTSW 9 108105307 missense
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499 missense
Z1177:Bsn UTSW 9 108139195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATCTGCTCTAGTTGCAGTCG -3'
(R):5'- AACTGCCCCTGCTGTCATCAAG -3'

Sequencing Primer
(F):5'- AGTCGCTGCTGTGCCAG -3'
(R):5'- TCAAGGAAgcccccgtg -3'
Posted On2013-07-30