Incidental Mutation 'R8231:Kyat1'
ID637130
Institutional Source Beutler Lab
Gene Symbol Kyat1
Ensembl Gene ENSMUSG00000039648
Gene Namekynurenine aminotransferase 1
SynonymsKat1, 2010009K05Rik, Ccbl1, KATI, cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location30185124-30205847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30191966 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 54 (T54A)
Ref Sequence ENSEMBL: ENSMUSP00000038612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044038] [ENSMUST00000113659] [ENSMUST00000113660] [ENSMUST00000113661] [ENSMUST00000113662] [ENSMUST00000113663]
Predicted Effect probably benign
Transcript: ENSMUST00000044038
AA Change: T54A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038612
Gene: ENSMUSG00000039648
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113659
AA Change: T54A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109289
Gene: ENSMUSG00000039648
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 53 365 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113660
AA Change: T54A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109290
Gene: ENSMUSG00000039648
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 145 1.7e-12 PFAM
Pfam:Aminotran_1_2 146 372 1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113661
AA Change: T54A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109291
Gene: ENSMUSG00000039648
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Pfam:DegT_DnrJ_EryC1 80 214 3.7e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113662
AA Change: T54A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109292
Gene: ENSMUSG00000039648
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Pfam:DegT_DnrJ_EryC1 80 214 3.7e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113663
AA Change: T54A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109293
Gene: ENSMUSG00000039648
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Pfam:DegT_DnrJ_EryC1 80 214 3.7e-6 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme that is responsible for the metabolism of cysteine conjugates of certain halogenated alkenes and alkanes. This metabolism can form reactive metabolites leading to nephrotoxicity and neurotoxicity. Increased levels of this enzyme have been linked to schizophrenia. Multiple transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in Kyat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Kyat1 APN 2 30185553 missense probably benign 0.00
IGL02216:Kyat1 APN 2 30187252 missense probably benign 0.44
IGL02864:Kyat1 APN 2 30192077 splice site probably benign
IGL02975:Kyat1 APN 2 30186675 missense probably damaging 0.99
R0193:Kyat1 UTSW 2 30187186 critical splice donor site probably null
R0230:Kyat1 UTSW 2 30194075 missense probably benign
R0539:Kyat1 UTSW 2 30188217 missense probably damaging 1.00
R2483:Kyat1 UTSW 2 30186698 missense possibly damaging 0.71
R3935:Kyat1 UTSW 2 30185749 missense probably damaging 1.00
R4651:Kyat1 UTSW 2 30194064 missense probably benign 0.00
R4685:Kyat1 UTSW 2 30188265 missense probably damaging 1.00
R5031:Kyat1 UTSW 2 30188090 missense probably damaging 1.00
R5699:Kyat1 UTSW 2 30186650 missense probably benign 0.01
R5722:Kyat1 UTSW 2 30188111 missense probably damaging 1.00
R7299:Kyat1 UTSW 2 30191995 missense probably benign 0.02
R8000:Kyat1 UTSW 2 30192053 missense probably benign
Z1176:Kyat1 UTSW 2 30187732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAGGTTCCTGATCTGCC -3'
(R):5'- AAATTGCCCCATGTATGTTCACTC -3'

Sequencing Primer
(F):5'- AGAAGGTTCCTGATCTGCCTTCTG -3'
(R):5'- ATGTATGTTCACTCTGACCCACAG -3'
Posted On2020-07-13